Incidental Mutation 'R9299:Cnot1'
ID 704799
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9299 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95719451-95807464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95741820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 1460 (I1460M)
Ref Sequence ENSEMBL: ENSMUSP00000063565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: I1460M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I1460M

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: I1465M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I1465M

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211887
AA Change: I1458M

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000211973
Predicted Effect probably benign
Transcript: ENSMUST00000212415
Predicted Effect probably damaging
Transcript: ENSMUST00000213006
AA Change: I1465M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G T 9: 57,256,509 R861S possibly damaging Het
Abca12 T A 1: 71,319,883 N588I possibly damaging Het
Adamts9 A G 6: 92,796,995 Y1727H probably benign Het
Ahnak G A 19: 9,012,460 probably benign Het
Alad C T 4: 62,511,523 probably null Het
Anapc15-ps C A 10: 95,673,215 D68Y probably damaging Het
Arhgap45 T C 10: 80,026,731 S645P possibly damaging Het
Atp9a A T 2: 168,712,746 M1K probably null Het
B020004C17Rik A T 14: 57,016,773 I118F probably damaging Het
Capn13 T A 17: 73,326,472 probably null Het
Ccdc7a T C 8: 128,889,838 Q928R probably benign Het
Cdc42bpa C A 1: 180,144,508 L1292I probably damaging Het
Clec2e A C 6: 129,095,129 F96V probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cyc1 T C 15: 76,344,306 V45A probably benign Het
Cyp4a10 A G 4: 115,519,750 M104V probably benign Het
Dnhd1 T A 7: 105,720,599 N4410K probably benign Het
Dok4 T A 8: 94,866,841 T106S probably benign Het
Dph1 T A 11: 75,179,796 Q339L possibly damaging Het
Dpy19l3 G T 7: 35,725,327 S187* probably null Het
Eva1a G T 6: 82,092,066 A125S probably damaging Het
Fam155a T C 8: 9,770,156 Y288C probably damaging Het
Fam207a C A 10: 77,515,701 A14S possibly damaging Het
Fam24b T A 7: 131,326,220 Y80F probably benign Het
Frem2 T C 3: 53,656,559 T176A probably benign Het
Gal3st3 A T 19: 5,306,840 N81I probably damaging Het
Gm12888 G A 4: 121,324,847 S16F unknown Het
Gm17018 C A 19: 45,577,570 Q203K probably damaging Het
Hsf5 T A 11: 87,635,944 C481S probably benign Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,728,995 probably benign Het
Ifi211 T A 1: 173,907,722 Q47L probably damaging Het
Il17re A T 6: 113,464,010 M202L probably benign Het
Krtap5-3 T A 7: 142,202,530 H175Q unknown Het
Ksr2 G A 5: 117,747,334 probably null Het
Lrtm1 C T 14: 29,021,757 P61S probably damaging Het
Ltk A T 2: 119,754,240 S487R possibly damaging Het
Mis18bp1 A T 12: 65,138,764 D876E possibly damaging Het
Olfr887 A G 9: 38,085,489 T218A probably benign Het
Paqr7 A G 4: 134,507,000 N56S probably benign Het
Pcdhb22 G T 18: 37,518,832 E118* probably null Het
Pcdhb4 G A 18: 37,309,211 A525T probably benign Het
Pik3cb A G 9: 99,061,791 F653S probably damaging Het
Pla2g4e T A 2: 120,171,723 D617V probably damaging Het
Plekha1 T A 7: 130,909,618 C311S possibly damaging Het
Poteg A G 8: 27,450,259 Y156C probably benign Het
Rev3l T C 10: 39,848,003 S2644P probably damaging Het
Rnf40 T A 7: 127,589,000 S2T probably benign Het
Rrp8 T C 7: 105,734,177 D294G probably damaging Het
Slc6a21 T C 7: 45,287,706 V252A Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
St6galnac6 G T 2: 32,612,333 R78L probably benign Het
Tbce T C 13: 14,019,813 K87R probably benign Het
Thada T C 17: 84,441,777 M589V probably benign Het
Thsd7a A G 6: 12,504,132 F341S Het
Tmem82 A T 4: 141,616,550 C136* probably null Het
Tmprss11a A T 5: 86,422,502 C199* probably null Het
Zbtb48 T C 4: 152,020,690 N505S possibly damaging Het
Zfp385b A T 2: 77,415,771 V304E probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Affiliate UTSW 8 95765125 missense probably damaging 0.99
Barge UTSW 8 95734129 missense probably benign 0.13
Byproduct UTSW 8 95745647 frame shift probably null
Chairman UTSW 8 95765027 missense possibly damaging 0.95
cohort UTSW 8 95735749 missense probably damaging 0.99
Director UTSW 8 95765062 missense probably benign 0.15
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7914:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R7981:Cnot1 UTSW 8 95763169 missense probably damaging 1.00
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8269:Cnot1 UTSW 8 95751761 missense probably damaging 1.00
R8306:Cnot1 UTSW 8 95747021 missense probably benign 0.05
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
R8427:Cnot1 UTSW 8 95734324 missense probably benign 0.01
R8723:Cnot1 UTSW 8 95736279 missense probably benign 0.00
R8934:Cnot1 UTSW 8 95765067 missense probably benign 0.04
R9025:Cnot1 UTSW 8 95749032 missense probably benign
R9280:Cnot1 UTSW 8 95770599 missense probably benign 0.15
R9285:Cnot1 UTSW 8 95726118 missense probably damaging 1.00
R9337:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TTCAGTGCTAAGGAGTTTGCC -3'
(R):5'- TGGATCGCTCAATTAAGATTGC -3'

Sequencing Primer
(F):5'- CAGTGCTAAGGAGTTTGCCCTAAC -3'
(R):5'- TGCTATGACTACGTGCGAAC -3'
Posted On 2022-03-25