Incidental Mutation 'R9299:B020004C17Rik'
ID 704813
Institutional Source Beutler Lab
Gene Symbol B020004C17Rik
Ensembl Gene ENSMUSG00000096144
Gene Name RIKEN cDNA B020004C17 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R9299 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 57015134-57018982 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 57016773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 118 (I118F)
Ref Sequence ENSEMBL: ENSMUSP00000137042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178161]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000178161
AA Change: I118F

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137042
Gene: ENSMUSG00000096144
AA Change: I118F

DomainStartEndE-ValueType
low complexity region 70 83 N/A INTRINSIC
low complexity region 221 231 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G T 9: 57,256,509 R861S possibly damaging Het
Abca12 T A 1: 71,319,883 N588I possibly damaging Het
Adamts9 A G 6: 92,796,995 Y1727H probably benign Het
Ahnak G A 19: 9,012,460 probably benign Het
Alad C T 4: 62,511,523 probably null Het
Anapc15-ps C A 10: 95,673,215 D68Y probably damaging Het
Arhgap45 T C 10: 80,026,731 S645P possibly damaging Het
Atp9a A T 2: 168,712,746 M1K probably null Het
Capn13 T A 17: 73,326,472 probably null Het
Ccdc7a T C 8: 128,889,838 Q928R probably benign Het
Cdc42bpa C A 1: 180,144,508 L1292I probably damaging Het
Clec2e A C 6: 129,095,129 F96V probably benign Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cnot1 T C 8: 95,741,820 I1460M probably damaging Het
Cyc1 T C 15: 76,344,306 V45A probably benign Het
Cyp4a10 A G 4: 115,519,750 M104V probably benign Het
Dnhd1 T A 7: 105,720,599 N4410K probably benign Het
Dok4 T A 8: 94,866,841 T106S probably benign Het
Dph1 T A 11: 75,179,796 Q339L possibly damaging Het
Dpy19l3 G T 7: 35,725,327 S187* probably null Het
Eva1a G T 6: 82,092,066 A125S probably damaging Het
Fam155a T C 8: 9,770,156 Y288C probably damaging Het
Fam207a C A 10: 77,515,701 A14S possibly damaging Het
Fam24b T A 7: 131,326,220 Y80F probably benign Het
Frem2 T C 3: 53,656,559 T176A probably benign Het
Gal3st3 A T 19: 5,306,840 N81I probably damaging Het
Gm12888 G A 4: 121,324,847 S16F unknown Het
Gm17018 C A 19: 45,577,570 Q203K probably damaging Het
Hsf5 T A 11: 87,635,944 C481S probably benign Het
Ifi207 GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT GAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGACTATTGGATGGTGTTGATAGAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATGAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGAT 1: 173,728,995 probably benign Het
Ifi211 T A 1: 173,907,722 Q47L probably damaging Het
Il17re A T 6: 113,464,010 M202L probably benign Het
Krtap5-3 T A 7: 142,202,530 H175Q unknown Het
Ksr2 G A 5: 117,747,334 probably null Het
Lrtm1 C T 14: 29,021,757 P61S probably damaging Het
Ltk A T 2: 119,754,240 S487R possibly damaging Het
Mis18bp1 A T 12: 65,138,764 D876E possibly damaging Het
Olfr887 A G 9: 38,085,489 T218A probably benign Het
Paqr7 A G 4: 134,507,000 N56S probably benign Het
Pcdhb22 G T 18: 37,518,832 E118* probably null Het
Pcdhb4 G A 18: 37,309,211 A525T probably benign Het
Pik3cb A G 9: 99,061,791 F653S probably damaging Het
Pla2g4e T A 2: 120,171,723 D617V probably damaging Het
Plekha1 T A 7: 130,909,618 C311S possibly damaging Het
Poteg A G 8: 27,450,259 Y156C probably benign Het
Rev3l T C 10: 39,848,003 S2644P probably damaging Het
Rnf40 T A 7: 127,589,000 S2T probably benign Het
Rrp8 T C 7: 105,734,177 D294G probably damaging Het
Slc6a21 T C 7: 45,287,706 V252A Het
Socs1 T C 16: 10,784,714 D53G possibly damaging Het
St6galnac6 G T 2: 32,612,333 R78L probably benign Het
Tbce T C 13: 14,019,813 K87R probably benign Het
Thada T C 17: 84,441,777 M589V probably benign Het
Thsd7a A G 6: 12,504,132 F341S Het
Tmem82 A T 4: 141,616,550 C136* probably null Het
Tmprss11a A T 5: 86,422,502 C199* probably null Het
Zbtb48 T C 4: 152,020,690 N505S possibly damaging Het
Zfp385b A T 2: 77,415,771 V304E probably damaging Het
Other mutations in B020004C17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:B020004C17Rik APN 14 57016023 missense probably damaging 0.96
IGL03396:B020004C17Rik APN 14 57016536 missense possibly damaging 0.61
R0664:B020004C17Rik UTSW 14 57016768 missense possibly damaging 0.56
R3977:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3978:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R3979:B020004C17Rik UTSW 14 57017188 missense possibly damaging 0.78
R4415:B020004C17Rik UTSW 14 57017417 makesense probably null
R5290:B020004C17Rik UTSW 14 57016579 missense possibly damaging 0.94
R5479:B020004C17Rik UTSW 14 57016542 missense probably benign 0.36
R5651:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5655:B020004C17Rik UTSW 14 57015232 start gained probably benign
R5736:B020004C17Rik UTSW 14 57017366 missense possibly damaging 0.66
R7368:B020004C17Rik UTSW 14 57017316 missense possibly damaging 0.95
R7759:B020004C17Rik UTSW 14 57016785 missense possibly damaging 0.96
R9410:B020004C17Rik UTSW 14 57016816 missense possibly damaging 0.92
Z1177:B020004C17Rik UTSW 14 57015260 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGTGGTTGAATATGAACTCAG -3'
(R):5'- GGAGGCCAGAATTTGTGCTG -3'

Sequencing Primer
(F):5'- TGGTTGAATATGAACTCAGAGACAC -3'
(R):5'- CCAGAATTTGTGCTGTGTGC -3'
Posted On 2022-03-25