Incidental Mutation 'R9300:Scn9a'
ID 704831
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9300 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 66480080-66634962 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66504892 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1251 (Y1251F)
Ref Sequence ENSEMBL: ENSMUSP00000097642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect possibly damaging
Transcript: ENSMUST00000100063
AA Change: Y1242F

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: Y1242F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100064
AA Change: Y1251F

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: Y1251F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112354
AA Change: Y1240F

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: Y1240F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164384
AA Change: Y1251F

PolyPhen 2 Score 0.391 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: Y1251F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169900
AA Change: Y1240F

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: Y1240F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Acad8 A T 9: 26,977,632 H371Q probably damaging Het
Actn3 G T 19: 4,871,628 R175S probably benign Het
Adamts9 G T 6: 92,887,390 D780E probably benign Het
AK157302 C A 13: 21,495,367 T21K probably benign Het
Ank3 A T 10: 69,871,042 H329L unknown Het
Ankrd36 A G 11: 5,569,979 H18R possibly damaging Het
Anks1b T A 10: 90,577,104 V38D possibly damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Arid1b C A 17: 5,242,999 P731T probably damaging Het
Atp1a4 A G 1: 172,239,831 F578S probably damaging Het
Atp6v0a2 A T 5: 124,712,248 I360F probably damaging Het
Bcas3 A T 11: 85,557,358 I600F probably damaging Het
C1qtnf7 T G 5: 43,609,099 C20W possibly damaging Het
Cadm1 A T 9: 47,797,523 K184* probably null Het
Ccdc138 A T 10: 58,507,626 H101L probably benign Het
Cep120 T A 18: 53,719,297 N503I probably damaging Het
Chil4 T C 3: 106,202,558 T380A probably benign Het
Clip2 A G 5: 134,498,088 probably null Het
Cyhr1 C A 15: 76,646,341 V260L probably benign Het
Cyp3a11 G A 5: 145,862,354 P341L possibly damaging Het
Cyp3a41a G C 5: 145,720,096 probably benign Het
Dcaf1 A G 9: 106,847,843 I509M possibly damaging Het
Dcaf13 T C 15: 39,146,707 S429P probably damaging Het
Eln A G 5: 134,729,366 V151A unknown Het
Endou T G 15: 97,713,073 M377L probably benign Het
Etfa A G 9: 55,488,868 I138T probably damaging Het
Fbxw10 T A 11: 62,877,283 S982T probably benign Het
Gm9602 A T 14: 4,777,288 R47* probably null Het
Hectd4 G A 5: 121,348,889 V3316I probably benign Het
Hif1a T C 12: 73,940,528 L477S probably benign Het
Icam5 G C 9: 21,035,550 G458A probably benign Het
Itm2b A T 14: 73,366,456 D106E probably benign Het
Kdelc1 A G 1: 44,117,202 I75T possibly damaging Het
Kdm4d G A 9: 14,464,040 T174M probably damaging Het
Kif16b G T 2: 142,699,287 D1364E probably benign Het
Lbhd1 G A 19: 8,884,186 V61M probably damaging Het
Lclat1 T A 17: 73,239,924 S279T probably benign Het
Lhx4 G A 1: 155,705,210 L190F probably damaging Het
Lima1 C T 15: 99,806,439 S283N probably benign Het
Magi1 C A 6: 93,747,228 D496Y probably damaging Het
Map1a T C 2: 121,302,965 S1421P probably damaging Het
Map3k20 C T 2: 72,371,913 H163Y probably damaging Het
Mier3 T G 13: 111,686,356 probably null Het
Mllt3 G A 4: 87,774,047 Q560* probably null Het
Mmp25 T A 17: 23,632,754 D327V probably benign Het
Nckap5 G A 1: 125,981,686 Q1603* probably null Het
Nell1 G A 7: 50,062,620 V63I probably benign Het
Olfr119 C T 17: 37,700,924 P85S probably damaging Het
Olfr151 A C 9: 37,730,282 S234A probably benign Het
Olfr701 A T 7: 106,818,904 I274F probably benign Het
Pde12 C T 14: 26,665,776 E526K probably damaging Het
Pfn4 T C 12: 4,775,442 V93A possibly damaging Het
Ppp2r3d A G 9: 124,423,977 S60P unknown Het
Prelp T C 1: 133,914,519 H296R probably damaging Het
Prickle1 T C 15: 93,500,868 E693G possibly damaging Het
Rars A G 11: 35,815,661 L477P probably damaging Het
Rasal1 G A 5: 120,664,107 R328H probably damaging Het
Rasef A G 4: 73,741,156 F220S probably benign Het
Rif1 C T 2: 52,111,139 S1535L probably damaging Het
Rnf17 T C 14: 56,460,038 I463T possibly damaging Het
Ryr3 A T 2: 112,860,350 D1138E probably benign Het
Sdk2 A G 11: 113,825,030 W1568R possibly damaging Het
Senp6 A G 9: 80,142,151 E1019G probably damaging Het
Shh A G 5: 28,458,463 Y236H probably damaging Het
Sin3a A G 9: 57,107,460 D655G probably damaging Het
Slc35a4 C T 18: 36,682,221 P35S probably damaging Het
Slc35g1 T C 19: 38,396,185 L24P probably benign Het
Slc39a4 G T 15: 76,614,559 Q312K probably damaging Het
Slc6a5 A T 7: 49,951,427 I659F probably damaging Het
Slc7a4 T C 16: 17,574,535 Y345C probably benign Het
Slco6c1 G T 1: 97,066,084 R645S probably benign Het
Soat1 T C 1: 156,441,353 Y209C probably benign Het
Tbc1d9b T C 11: 50,163,887 S953P probably benign Het
Tgm1 G A 14: 55,704,846 H683Y probably benign Het
Tmem98 G A 11: 80,817,606 R134Q probably damaging Het
Trpm3 A C 19: 22,978,381 M1107L possibly damaging Het
Vmn1r11 G A 6: 57,137,887 V179I probably benign Het
Vmn1r119 G T 7: 21,011,713 T248K probably damaging Het
Vmn1r236 T A 17: 21,286,683 I21N possibly damaging Het
Vmn2r24 A G 6: 123,816,071 T786A possibly damaging Het
Vstm5 A T 9: 15,257,289 I50F probably damaging Het
Wdr1 T C 5: 38,527,912 D572G probably damaging Het
Xaf1 T C 11: 72,301,691 F5S probably benign Het
Zan A T 5: 137,470,257 probably null Het
Zfp697 T C 3: 98,427,663 V248A possibly damaging Het
Zkscan3 T A 13: 21,393,497 T249S unknown Het
Znfx1 A G 2: 167,055,940 Y355H probably damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
BB007:Scn9a UTSW 2 66504849 missense probably damaging 0.99
BB017:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7653:Scn9a UTSW 2 66527080 missense probably damaging 1.00
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
R7864:Scn9a UTSW 2 66484560 missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66543112 missense probably benign 0.00
R7930:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R7975:Scn9a UTSW 2 66484253 missense probably damaging 1.00
R8057:Scn9a UTSW 2 66515430 missense probably benign 0.06
R8145:Scn9a UTSW 2 66487410 missense probably damaging 1.00
R8163:Scn9a UTSW 2 66484401 missense probably damaging 1.00
R8165:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R8342:Scn9a UTSW 2 66536282 missense probably benign
R8345:Scn9a UTSW 2 66494622 missense probably damaging 0.96
R8464:Scn9a UTSW 2 66566281 missense probably damaging 0.99
R8467:Scn9a UTSW 2 66501671 missense probably damaging 1.00
R8698:Scn9a UTSW 2 66536284 missense probably benign 0.00
R8810:Scn9a UTSW 2 66501666 missense probably damaging 1.00
R8822:Scn9a UTSW 2 66540635 missense probably damaging 0.99
R8829:Scn9a UTSW 2 66483617 missense probably benign
R9009:Scn9a UTSW 2 66508583 missense probably damaging 1.00
R9038:Scn9a UTSW 2 66494803 missense probably damaging 1.00
R9126:Scn9a UTSW 2 66484400 missense probably damaging 1.00
R9205:Scn9a UTSW 2 66533313 missense probably damaging 1.00
R9373:Scn9a UTSW 2 66483917 missense probably benign 0.00
R9404:Scn9a UTSW 2 66526696 missense probably benign 0.02
R9443:Scn9a UTSW 2 66565209 missense probably damaging 1.00
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66540592 missense probably benign 0.00
Z1177:Scn9a UTSW 2 66494685 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TAGAAAGACTCATCTGCCCTTTTC -3'
(R):5'- AGCCAAGTTGTTTTCACACC -3'

Sequencing Primer
(F):5'- AGTTTGCAAGTCCAATGGGCC -3'
(R):5'- GTTTCCACAGGCTTTTGAG -3'
Posted On 2022-03-25