Incidental Mutation 'R9300:Chil4'
ID 704838
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Name chitinase-like 4
Synonyms Chi3l4, Ym2
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9300 (G1)
Quality Score 207.009
Status Not validated
Chromosome 3
Chromosomal Location 106108807-106126795 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106109874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 380 (T380A)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
AlphaFold Q91Z98
Predicted Effect probably benign
Transcript: ENSMUST00000082219
AA Change: T380A

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: T380A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,875,614 (GRCm39) V596I probably benign Het
Acad8 A T 9: 26,888,928 (GRCm39) H371Q probably damaging Het
Actn3 G T 19: 4,921,656 (GRCm39) R175S probably benign Het
Adamts9 G T 6: 92,864,371 (GRCm39) D780E probably benign Het
AK157302 C A 13: 21,679,537 (GRCm39) T21K probably benign Het
Ank3 A T 10: 69,706,872 (GRCm39) H329L unknown Het
Ankrd36 A G 11: 5,519,979 (GRCm39) H18R possibly damaging Het
Anks1b T A 10: 90,412,966 (GRCm39) V38D possibly damaging Het
Apbb2 A T 5: 66,470,677 (GRCm39) L520H probably damaging Het
Arid1b C A 17: 5,293,274 (GRCm39) P731T probably damaging Het
Atp1a4 A G 1: 172,067,398 (GRCm39) F578S probably damaging Het
Atp6v0a2 A T 5: 124,789,312 (GRCm39) I360F probably damaging Het
Bcas3 A T 11: 85,448,184 (GRCm39) I600F probably damaging Het
C1qtnf7 T G 5: 43,766,441 (GRCm39) C20W possibly damaging Het
Cadm1 A T 9: 47,708,821 (GRCm39) K184* probably null Het
Ccdc138 A T 10: 58,343,448 (GRCm39) H101L probably benign Het
Cep120 T A 18: 53,852,369 (GRCm39) N503I probably damaging Het
Clip2 A G 5: 134,526,942 (GRCm39) probably null Het
Cyp3a11 G A 5: 145,799,164 (GRCm39) P341L possibly damaging Het
Cyp3a41a G C 5: 145,656,906 (GRCm39) probably benign Het
Dcaf1 A G 9: 106,725,042 (GRCm39) I509M possibly damaging Het
Dcaf13 T C 15: 39,010,102 (GRCm39) S429P probably damaging Het
Eln A G 5: 134,758,220 (GRCm39) V151A unknown Het
Endou T G 15: 97,610,954 (GRCm39) M377L probably benign Het
Etfa A G 9: 55,396,152 (GRCm39) I138T probably damaging Het
Fbxw10 T A 11: 62,768,109 (GRCm39) S982T probably benign Het
Gm9602 A T 14: 15,933,435 (GRCm39) R47* probably null Het
Hectd4 G A 5: 121,486,952 (GRCm39) V3316I probably benign Het
Hif1a T C 12: 73,987,302 (GRCm39) L477S probably benign Het
Icam5 G C 9: 20,946,846 (GRCm39) G458A probably benign Het
Itm2b A T 14: 73,603,896 (GRCm39) D106E probably benign Het
Kdm4d G A 9: 14,375,336 (GRCm39) T174M probably damaging Het
Kif16b G T 2: 142,541,207 (GRCm39) D1364E probably benign Het
Lbhd1 G A 19: 8,861,550 (GRCm39) V61M probably damaging Het
Lclat1 T A 17: 73,546,919 (GRCm39) S279T probably benign Het
Lhx4 G A 1: 155,580,956 (GRCm39) L190F probably damaging Het
Lima1 C T 15: 99,704,320 (GRCm39) S283N probably benign Het
Magi1 C A 6: 93,724,209 (GRCm39) D496Y probably damaging Het
Map1a T C 2: 121,133,446 (GRCm39) S1421P probably damaging Het
Map3k20 C T 2: 72,202,257 (GRCm39) H163Y probably damaging Het
Mier3 T G 13: 111,822,890 (GRCm39) probably null Het
Mllt3 G A 4: 87,692,284 (GRCm39) Q560* probably null Het
Mmp25 T A 17: 23,851,728 (GRCm39) D327V probably benign Het
Nckap5 G A 1: 125,909,423 (GRCm39) Q1603* probably null Het
Nell1 G A 7: 49,712,368 (GRCm39) V63I probably benign Het
Or10al3 C T 17: 38,011,815 (GRCm39) P85S probably damaging Het
Or2ag2b A T 7: 106,418,111 (GRCm39) I274F probably benign Het
Or8a1 A C 9: 37,641,578 (GRCm39) S234A probably benign Het
Pde12 C T 14: 26,386,931 (GRCm39) E526K probably damaging Het
Pfn4 T C 12: 4,825,442 (GRCm39) V93A possibly damaging Het
Poglut2 A G 1: 44,156,362 (GRCm39) I75T possibly damaging Het
Ppp2r3d A G 9: 124,423,977 (GRCm38) S60P unknown Het
Prelp T C 1: 133,842,257 (GRCm39) H296R probably damaging Het
Prickle1 T C 15: 93,398,749 (GRCm39) E693G possibly damaging Het
Rars1 A G 11: 35,706,488 (GRCm39) L477P probably damaging Het
Rasal1 G A 5: 120,802,172 (GRCm39) R328H probably damaging Het
Rasef A G 4: 73,659,393 (GRCm39) F220S probably benign Het
Rif1 C T 2: 52,001,151 (GRCm39) S1535L probably damaging Het
Rnf17 T C 14: 56,697,495 (GRCm39) I463T possibly damaging Het
Ryr3 A T 2: 112,690,695 (GRCm39) D1138E probably benign Het
Scn9a T A 2: 66,335,236 (GRCm39) Y1251F probably benign Het
Sdk2 A G 11: 113,715,856 (GRCm39) W1568R possibly damaging Het
Senp6 A G 9: 80,049,433 (GRCm39) E1019G probably damaging Het
Shh A G 5: 28,663,461 (GRCm39) Y236H probably damaging Het
Sin3a A G 9: 57,014,744 (GRCm39) D655G probably damaging Het
Slc35a4 C T 18: 36,815,274 (GRCm39) P35S probably damaging Het
Slc35g1 T C 19: 38,384,633 (GRCm39) L24P probably benign Het
Slc39a4 G T 15: 76,498,759 (GRCm39) Q312K probably damaging Het
Slc6a5 A T 7: 49,601,175 (GRCm39) I659F probably damaging Het
Slc7a4 T C 16: 17,392,399 (GRCm39) Y345C probably benign Het
Slco6c1 G T 1: 96,993,809 (GRCm39) R645S probably benign Het
Soat1 T C 1: 156,268,923 (GRCm39) Y209C probably benign Het
Tbc1d9b T C 11: 50,054,714 (GRCm39) S953P probably benign Het
Tgm1 G A 14: 55,942,303 (GRCm39) H683Y probably benign Het
Tmem98 G A 11: 80,708,432 (GRCm39) R134Q probably damaging Het
Trpm3 A C 19: 22,955,745 (GRCm39) M1107L possibly damaging Het
Vmn1r11 G A 6: 57,114,872 (GRCm39) V179I probably benign Het
Vmn1r119 G T 7: 20,745,638 (GRCm39) T248K probably damaging Het
Vmn1r236 T A 17: 21,506,945 (GRCm39) I21N possibly damaging Het
Vmn2r24 A G 6: 123,793,030 (GRCm39) T786A possibly damaging Het
Vstm5 A T 9: 15,168,585 (GRCm39) I50F probably damaging Het
Wdr1 T C 5: 38,685,255 (GRCm39) D572G probably damaging Het
Xaf1 T C 11: 72,192,517 (GRCm39) F5S probably benign Het
Zan A T 5: 137,468,519 (GRCm39) probably null Het
Zfp697 T C 3: 98,334,979 (GRCm39) V248A possibly damaging Het
Zftraf1 C A 15: 76,530,541 (GRCm39) V260L probably benign Het
Zkscan3 T A 13: 21,577,667 (GRCm39) T249S unknown Het
Znfx1 A G 2: 166,897,860 (GRCm39) Y355H probably damaging Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106,109,113 (GRCm39) missense probably benign
IGL02457:Chil4 APN 3 106,121,715 (GRCm39) missense probably benign
R1087:Chil4 UTSW 3 106,117,881 (GRCm39) missense probably benign 0.01
R1398:Chil4 UTSW 3 106,126,825 (GRCm39) splice site probably null
R1503:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign
R1553:Chil4 UTSW 3 106,111,006 (GRCm39) missense probably benign 0.02
R1806:Chil4 UTSW 3 106,117,959 (GRCm39) splice site probably benign
R1873:Chil4 UTSW 3 106,113,414 (GRCm39) missense probably benign 0.00
R2069:Chil4 UTSW 3 106,126,771 (GRCm39) missense probably benign 0.16
R2100:Chil4 UTSW 3 106,121,663 (GRCm39) missense probably benign
R2370:Chil4 UTSW 3 106,121,616 (GRCm39) nonsense probably null
R2984:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106,111,056 (GRCm39) missense probably benign 0.08
R3919:Chil4 UTSW 3 106,109,848 (GRCm39) missense probably benign 0.00
R4033:Chil4 UTSW 3 106,121,765 (GRCm39) missense probably damaging 1.00
R4181:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106,110,144 (GRCm39) missense probably benign
R4391:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106,121,678 (GRCm39) missense probably damaging 1.00
R4544:Chil4 UTSW 3 106,117,922 (GRCm39) missense probably damaging 0.97
R4887:Chil4 UTSW 3 106,111,460 (GRCm39) missense probably benign 0.01
R4949:Chil4 UTSW 3 106,113,408 (GRCm39) missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106,109,913 (GRCm39) missense probably damaging 1.00
R5146:Chil4 UTSW 3 106,110,150 (GRCm39) missense probably benign 0.18
R5254:Chil4 UTSW 3 106,126,768 (GRCm39) missense probably benign 0.00
R5521:Chil4 UTSW 3 106,111,013 (GRCm39) missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106,109,894 (GRCm39) missense probably benign 0.00
R5883:Chil4 UTSW 3 106,117,886 (GRCm39) missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106,121,711 (GRCm39) missense probably damaging 1.00
R6257:Chil4 UTSW 3 106,111,412 (GRCm39) missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106,111,487 (GRCm39) missense probably damaging 1.00
R6602:Chil4 UTSW 3 106,117,906 (GRCm39) missense probably benign 0.00
R7113:Chil4 UTSW 3 106,121,664 (GRCm39) missense probably benign
R7113:Chil4 UTSW 3 106,110,083 (GRCm39) missense probably damaging 1.00
R7188:Chil4 UTSW 3 106,111,475 (GRCm39) missense probably damaging 1.00
R7980:Chil4 UTSW 3 106,110,060 (GRCm39) missense probably damaging 1.00
R8810:Chil4 UTSW 3 106,109,121 (GRCm39) missense probably damaging 0.99
R9307:Chil4 UTSW 3 106,111,382 (GRCm39) critical splice donor site probably null
R9529:Chil4 UTSW 3 106,118,656 (GRCm39) missense probably damaging 1.00
X0067:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACATCAAGGTATCCCTGGTTC -3'
(R):5'- CTGAATGTGCTGAGATTGCAG -3'

Sequencing Primer
(F):5'- CCTGGTTCCTAATAAGTGTGCAAC -3'
(R):5'- TGAGATTGCAGCCTGATTCCCAG -3'
Posted On 2022-03-25