Incidental Mutation 'R9300:Dcaf13'
ID 704894
Institutional Source Beutler Lab
Gene Symbol Dcaf13
Ensembl Gene ENSMUSG00000022300
Gene Name DDB1 and CUL4 associated factor 13
Synonyms LOC223499, Wdsof1
Accession Numbers

Genbank: NM_198606; MGI: 2684929

Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R9300 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 39112865-39146856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39146707 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 429 (S429P)
Ref Sequence ENSEMBL: ENSMUSP00000022909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022909]
AlphaFold Q6PAC3
Predicted Effect probably damaging
Transcript: ENSMUST00000022909
AA Change: S429P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022909
Gene: ENSMUSG00000022300
AA Change: S429P

DomainStartEndE-ValueType
WD40 55 95 5.77e-5 SMART
WD40 98 137 4.38e-5 SMART
WD40 185 225 5.97e-1 SMART
Blast:WD40 228 267 1e-18 BLAST
WD40 271 310 2.69e-5 SMART
WD40 312 353 2.96e-2 SMART
Pfam:Sof1 354 440 7.2e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,825,614 V596I probably benign Het
Acad8 A T 9: 26,977,632 H371Q probably damaging Het
Actn3 G T 19: 4,871,628 R175S probably benign Het
Adamts9 G T 6: 92,887,390 D780E probably benign Het
AK157302 C A 13: 21,495,367 T21K probably benign Het
Ank3 A T 10: 69,871,042 H329L unknown Het
Ankrd36 A G 11: 5,569,979 H18R possibly damaging Het
Anks1b T A 10: 90,577,104 V38D possibly damaging Het
Apbb2 A T 5: 66,313,334 L520H probably damaging Het
Arid1b C A 17: 5,242,999 P731T probably damaging Het
Atp1a4 A G 1: 172,239,831 F578S probably damaging Het
Atp6v0a2 A T 5: 124,712,248 I360F probably damaging Het
Bcas3 A T 11: 85,557,358 I600F probably damaging Het
C1qtnf7 T G 5: 43,609,099 C20W possibly damaging Het
Cadm1 A T 9: 47,797,523 K184* probably null Het
Ccdc138 A T 10: 58,507,626 H101L probably benign Het
Cep120 T A 18: 53,719,297 N503I probably damaging Het
Chil4 T C 3: 106,202,558 T380A probably benign Het
Clip2 A G 5: 134,498,088 probably null Het
Cyhr1 C A 15: 76,646,341 V260L probably benign Het
Cyp3a11 G A 5: 145,862,354 P341L possibly damaging Het
Cyp3a41a G C 5: 145,720,096 probably benign Het
Dcaf1 A G 9: 106,847,843 I509M possibly damaging Het
Eln A G 5: 134,729,366 V151A unknown Het
Endou T G 15: 97,713,073 M377L probably benign Het
Etfa A G 9: 55,488,868 I138T probably damaging Het
Fbxw10 T A 11: 62,877,283 S982T probably benign Het
Gm9602 A T 14: 4,777,288 R47* probably null Het
Hectd4 G A 5: 121,348,889 V3316I probably benign Het
Hif1a T C 12: 73,940,528 L477S probably benign Het
Icam5 G C 9: 21,035,550 G458A probably benign Het
Itm2b A T 14: 73,366,456 D106E probably benign Het
Kdelc1 A G 1: 44,117,202 I75T possibly damaging Het
Kdm4d G A 9: 14,464,040 T174M probably damaging Het
Kif16b G T 2: 142,699,287 D1364E probably benign Het
Lbhd1 G A 19: 8,884,186 V61M probably damaging Het
Lclat1 T A 17: 73,239,924 S279T probably benign Het
Lhx4 G A 1: 155,705,210 L190F probably damaging Het
Lima1 C T 15: 99,806,439 S283N probably benign Het
Magi1 C A 6: 93,747,228 D496Y probably damaging Het
Map1a T C 2: 121,302,965 S1421P probably damaging Het
Map3k20 C T 2: 72,371,913 H163Y probably damaging Het
Mier3 T G 13: 111,686,356 probably null Het
Mllt3 G A 4: 87,774,047 Q560* probably null Het
Mmp25 T A 17: 23,632,754 D327V probably benign Het
Nckap5 G A 1: 125,981,686 Q1603* probably null Het
Nell1 G A 7: 50,062,620 V63I probably benign Het
Olfr119 C T 17: 37,700,924 P85S probably damaging Het
Olfr151 A C 9: 37,730,282 S234A probably benign Het
Olfr701 A T 7: 106,818,904 I274F probably benign Het
Pde12 C T 14: 26,665,776 E526K probably damaging Het
Pfn4 T C 12: 4,775,442 V93A possibly damaging Het
Ppp2r3d A G 9: 124,423,977 S60P unknown Het
Prelp T C 1: 133,914,519 H296R probably damaging Het
Prickle1 T C 15: 93,500,868 E693G possibly damaging Het
Rars A G 11: 35,815,661 L477P probably damaging Het
Rasal1 G A 5: 120,664,107 R328H probably damaging Het
Rasef A G 4: 73,741,156 F220S probably benign Het
Rif1 C T 2: 52,111,139 S1535L probably damaging Het
Rnf17 T C 14: 56,460,038 I463T possibly damaging Het
Ryr3 A T 2: 112,860,350 D1138E probably benign Het
Scn9a T A 2: 66,504,892 Y1251F probably benign Het
Sdk2 A G 11: 113,825,030 W1568R possibly damaging Het
Senp6 A G 9: 80,142,151 E1019G probably damaging Het
Shh A G 5: 28,458,463 Y236H probably damaging Het
Sin3a A G 9: 57,107,460 D655G probably damaging Het
Slc35a4 C T 18: 36,682,221 P35S probably damaging Het
Slc35g1 T C 19: 38,396,185 L24P probably benign Het
Slc39a4 G T 15: 76,614,559 Q312K probably damaging Het
Slc6a5 A T 7: 49,951,427 I659F probably damaging Het
Slc7a4 T C 16: 17,574,535 Y345C probably benign Het
Slco6c1 G T 1: 97,066,084 R645S probably benign Het
Soat1 T C 1: 156,441,353 Y209C probably benign Het
Tbc1d9b T C 11: 50,163,887 S953P probably benign Het
Tgm1 G A 14: 55,704,846 H683Y probably benign Het
Tmem98 G A 11: 80,817,606 R134Q probably damaging Het
Trpm3 A C 19: 22,978,381 M1107L possibly damaging Het
Vmn1r11 G A 6: 57,137,887 V179I probably benign Het
Vmn1r119 G T 7: 21,011,713 T248K probably damaging Het
Vmn1r236 T A 17: 21,286,683 I21N possibly damaging Het
Vmn2r24 A G 6: 123,816,071 T786A possibly damaging Het
Vstm5 A T 9: 15,257,289 I50F probably damaging Het
Wdr1 T C 5: 38,527,912 D572G probably damaging Het
Xaf1 T C 11: 72,301,691 F5S probably benign Het
Zan A T 5: 137,470,257 probably null Het
Zfp697 T C 3: 98,427,663 V248A possibly damaging Het
Zkscan3 T A 13: 21,393,497 T249S unknown Het
Znfx1 A G 2: 167,055,940 Y355H probably damaging Het
Other mutations in Dcaf13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Dcaf13 APN 15 39143632 nonsense probably null
IGL01081:Dcaf13 APN 15 39118806 missense probably damaging 1.00
IGL01766:Dcaf13 APN 15 39118750 missense probably benign 0.00
IGL02174:Dcaf13 APN 15 39138149 missense probably damaging 1.00
IGL02262:Dcaf13 APN 15 39118707 splice site probably benign
IGL02740:Dcaf13 APN 15 39145100 nonsense probably null
IGL03092:Dcaf13 APN 15 39127976 splice site probably benign
IGL03374:Dcaf13 APN 15 39145148 nonsense probably null
R0590:Dcaf13 UTSW 15 39145085 splice site probably benign
R0594:Dcaf13 UTSW 15 39123268 missense probably benign 0.00
R0711:Dcaf13 UTSW 15 39138089 missense probably damaging 1.00
R1036:Dcaf13 UTSW 15 39143718 missense probably damaging 1.00
R1770:Dcaf13 UTSW 15 39130238 missense probably damaging 1.00
R1826:Dcaf13 UTSW 15 39118899 missense probably damaging 1.00
R1933:Dcaf13 UTSW 15 39138088 missense probably damaging 0.99
R2508:Dcaf13 UTSW 15 39145152 missense probably benign
R4113:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
R4595:Dcaf13 UTSW 15 39118893 missense probably damaging 1.00
R4649:Dcaf13 UTSW 15 39138242 missense possibly damaging 0.54
R5431:Dcaf13 UTSW 15 39123224 missense probably benign 0.16
R5454:Dcaf13 UTSW 15 39124364 missense probably benign
R5834:Dcaf13 UTSW 15 39143642 nonsense probably null
R5929:Dcaf13 UTSW 15 39143653 missense possibly damaging 0.89
R5944:Dcaf13 UTSW 15 39146677 missense probably benign
R6319:Dcaf13 UTSW 15 39143672 missense probably benign 0.00
R6394:Dcaf13 UTSW 15 39143737 missense probably benign 0.04
R6664:Dcaf13 UTSW 15 39118888 missense probably damaging 1.00
R6884:Dcaf13 UTSW 15 39123240 missense probably damaging 1.00
R7419:Dcaf13 UTSW 15 39130220 missense probably damaging 0.98
R8750:Dcaf13 UTSW 15 39119441 missense probably damaging 1.00
R8944:Dcaf13 UTSW 15 39138217 missense possibly damaging 0.79
R9294:Dcaf13 UTSW 15 39130292 missense possibly damaging 0.92
Z1088:Dcaf13 UTSW 15 39145247 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAACTTAGTAAGGGATGCTGGG -3'
(R):5'- GCACAGCTGGCTCTTAGATC -3'

Sequencing Primer
(F):5'- GCATGCAGCACTAAGGTGTATTCC -3'
(R):5'- ACAGCTGGCTCTTAGATCAGTGC -3'
Posted On 2022-03-25