Incidental Mutation 'R0737:Fmo4'
ID70491
Institutional Source Beutler Lab
Gene Symbol Fmo4
Ensembl Gene ENSMUSG00000026692
Gene Nameflavin containing monooxygenase 4
Synonyms
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162793188-162813972 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 162808392 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 14 (K14*)
Ref Sequence ENSEMBL: ENSMUSP00000119389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028014] [ENSMUST00000111525] [ENSMUST00000140274] [ENSMUST00000144916]
Predicted Effect probably null
Transcript: ENSMUST00000028014
AA Change: K64*
SMART Domains Protein: ENSMUSP00000028014
Gene: ENSMUSG00000026692
AA Change: K64*

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 4 430 1e-8 PFAM
Pfam:Pyr_redox_3 6 220 5.1e-16 PFAM
Pfam:K_oxygenase 68 227 1.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111525
AA Change: K64*
SMART Domains Protein: ENSMUSP00000107150
Gene: ENSMUSG00000026692
AA Change: K64*

DomainStartEndE-ValueType
Pfam:FMO-like 2 531 9.4e-272 PFAM
Pfam:Pyr_redox_2 3 225 1.7e-11 PFAM
Pfam:Pyr_redox_3 6 220 2.5e-9 PFAM
Pfam:K_oxygenase 67 227 6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140031
Predicted Effect probably null
Transcript: ENSMUST00000140274
AA Change: K64*
SMART Domains Protein: ENSMUSP00000118476
Gene: ENSMUSG00000026692
AA Change: K64*

DomainStartEndE-ValueType
Pfam:FMO-like 2 99 1.5e-57 PFAM
Pfam:NAD_binding_8 7 94 1.6e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000144916
AA Change: K14*
SMART Domains Protein: ENSMUSP00000119389
Gene: ENSMUSG00000026692
AA Change: K14*

DomainStartEndE-ValueType
Pfam:FMO-like 1 114 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193508
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man. This results in a small subpopulation with reduced TMA N-oxidation capacity and causes fish odor syndrome (Trimethylaminuria). Three forms of the enzyme are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Fmo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Fmo4 APN 1 162794023 missense probably benign 0.00
IGL01090:Fmo4 APN 1 162809785 splice site probably null
IGL01295:Fmo4 APN 1 162799124 missense probably damaging 1.00
IGL02089:Fmo4 APN 1 162799080 missense probably benign 0.04
IGL02483:Fmo4 APN 1 162808421 missense possibly damaging 0.60
R0608:Fmo4 UTSW 1 162803651 missense possibly damaging 0.95
R0660:Fmo4 UTSW 1 162809848 missense probably benign 0.05
R1117:Fmo4 UTSW 1 162803663 missense probably benign 0.03
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1464:Fmo4 UTSW 1 162794355 missense possibly damaging 0.54
R1577:Fmo4 UTSW 1 162803700 missense possibly damaging 0.50
R1792:Fmo4 UTSW 1 162794290 missense probably benign
R1875:Fmo4 UTSW 1 162803618 missense possibly damaging 0.95
R1929:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R1956:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1957:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R1958:Fmo4 UTSW 1 162803690 missense probably benign 0.01
R2011:Fmo4 UTSW 1 162798889 missense probably damaging 1.00
R2030:Fmo4 UTSW 1 162794172 missense probably damaging 1.00
R2072:Fmo4 UTSW 1 162809887 missense probably benign 0.20
R2272:Fmo4 UTSW 1 162799047 missense possibly damaging 0.95
R3890:Fmo4 UTSW 1 162794055 missense probably benign 0.39
R4255:Fmo4 UTSW 1 162794326 missense probably benign 0.00
R4273:Fmo4 UTSW 1 162805179 missense probably damaging 0.97
R4760:Fmo4 UTSW 1 162809827 missense probably damaging 1.00
R5445:Fmo4 UTSW 1 162805273 missense probably benign 0.24
R5726:Fmo4 UTSW 1 162808259 critical splice donor site probably null
R5786:Fmo4 UTSW 1 162803717 missense probably benign 0.00
R6391:Fmo4 UTSW 1 162793969 nonsense probably null
R6826:Fmo4 UTSW 1 162803769 missense probably damaging 1.00
R7457:Fmo4 UTSW 1 162794103 missense probably benign 0.00
R7913:Fmo4 UTSW 1 162794172 missense possibly damaging 0.69
R8031:Fmo4 UTSW 1 162798852 nonsense probably null
R8055:Fmo4 UTSW 1 162808446 missense probably benign
R8234:Fmo4 UTSW 1 162805188 missense probably damaging 1.00
R8346:Fmo4 UTSW 1 162794223 missense probably benign 0.01
X0020:Fmo4 UTSW 1 162794378 missense probably benign 0.02
Z1177:Fmo4 UTSW 1 162803720 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGATTGCTGACTAGGCCAGCCTC -3'
(R):5'- CAATTGTGTGCCGTCATCAGCTTC -3'

Sequencing Primer
(F):5'- CCGTTCACGAACTTTCCATAAC -3'
(R):5'- ATGTCTTATCCTGGCAACACGG -3'
Posted On2013-09-30