Incidental Mutation 'R9301:Zbtb49'
ID 704935
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Name zinc finger and BTB domain containing 49
Synonyms Zfp509, 4930518A03Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 38347076-38377798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38370931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 317 (C317R)
Ref Sequence ENSEMBL: ENSMUSP00000092429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000114113] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436]
AlphaFold Q8BXX2
Predicted Effect probably benign
Transcript: ENSMUST00000094833
AA Change: C317R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: C317R

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114113
AA Change: C317R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000109748
Gene: ENSMUSG00000029127
AA Change: C317R

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
low complexity region 413 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126267
AA Change: C317R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127
AA Change: C317R

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect probably benign
Transcript: ENSMUST00000136475
AA Change: C317R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127
AA Change: C317R

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,881,128 (GRCm39) N514K probably benign Het
Adss1 A T 12: 112,602,882 (GRCm39) R358W probably damaging Het
Anxa8 T A 14: 33,819,932 (GRCm39) I307N probably damaging Het
Atad5 T A 11: 79,986,845 (GRCm39) I644N probably damaging Het
Atp5f1a G T 18: 77,868,938 (GRCm39) L437F probably damaging Het
Babam1 A G 8: 71,855,684 (GRCm39) K259R possibly damaging Het
BC048562 T G 9: 108,323,054 (GRCm39) F130V probably damaging Het
Btf3l4b T A 13: 96,217,621 (GRCm39) K73* probably null Het
Camsap2 T A 1: 136,202,640 (GRCm39) probably null Het
Ccne2 A G 4: 11,192,881 (GRCm39) I27M probably benign Het
Cd302 A G 2: 60,082,793 (GRCm39) V177A possibly damaging Het
Cfap46 T C 7: 139,222,461 (GRCm39) K1172R Het
Cic T C 7: 24,991,117 (GRCm39) W2141R probably damaging Het
Cpeb3 A G 19: 37,151,473 (GRCm39) V301A possibly damaging Het
Cpsf3 A G 12: 21,350,112 (GRCm39) K277R possibly damaging Het
Cstl1 A G 2: 148,592,926 (GRCm39) H27R possibly damaging Het
Dapk1 T A 13: 60,866,125 (GRCm39) I188K possibly damaging Het
Dock6 T C 9: 21,729,111 (GRCm39) T1301A probably benign Het
Eml5 A T 12: 98,848,292 (GRCm39) C133* probably null Het
Ermap T A 4: 119,042,744 (GRCm39) I260F probably damaging Het
Fbxw22 T G 9: 109,215,653 (GRCm39) E198D possibly damaging Het
Flt4 T C 11: 49,516,241 (GRCm39) Y115H possibly damaging Het
Fmo9 A C 1: 166,494,794 (GRCm39) I369S probably damaging Het
Frmd4a T A 2: 4,157,904 (GRCm39) S6T probably benign Het
Golga5 A T 12: 102,443,057 (GRCm39) I330L probably benign Het
Helq C A 5: 100,927,158 (GRCm39) V643F probably damaging Het
Ino80d A T 1: 63,104,969 (GRCm39) L369H probably damaging Het
Kank1 A T 19: 25,388,798 (GRCm39) M824L probably benign Het
Lilrb4b T C 10: 51,356,801 (GRCm39) probably benign Het
Ltbp4 T A 7: 27,021,578 (GRCm39) D1003V probably damaging Het
Mapk8ip2 T C 15: 89,341,886 (GRCm39) S366P probably damaging Het
Mdga1 T C 17: 30,069,512 (GRCm39) H178R probably benign Het
Mlh3 A G 12: 85,292,613 (GRCm39) V1266A possibly damaging Het
Nrp1 A G 8: 129,089,859 (GRCm39) E78G probably damaging Het
Or1l4 A T 2: 37,091,255 (GRCm39) M1L probably benign Het
Or4z4 A T 19: 12,076,826 (GRCm39) M59K probably damaging Het
Or5d16 A G 2: 87,773,297 (GRCm39) V225A probably benign Het
Or8k33 A G 2: 86,383,818 (GRCm39) S217P possibly damaging Het
Ovch2 A G 7: 107,395,815 (GRCm39) S68P probably damaging Het
Pappa2 T A 1: 158,672,614 (GRCm39) I1110F probably damaging Het
Pcyox1 A C 6: 86,369,241 (GRCm39) L195R possibly damaging Het
Pde11a A G 2: 75,848,217 (GRCm39) L870P probably damaging Het
Pgpep1 G A 8: 71,103,418 (GRCm39) T152M probably damaging Het
Pik3c2a A T 7: 115,945,413 (GRCm39) D1464E probably damaging Het
Plcb1 A G 2: 135,167,610 (GRCm39) K468R possibly damaging Het
Postn C T 3: 54,292,659 (GRCm39) T742I probably benign Het
Ppm1j T A 3: 104,691,057 (GRCm39) Y274N probably damaging Het
Ppp2cb T C 8: 34,090,038 (GRCm39) C32R possibly damaging Het
Prmt9 T A 8: 78,282,374 (GRCm39) Y90* probably null Het
Ptk2 T C 15: 73,146,346 (GRCm39) Y441C probably damaging Het
Rabggta T A 14: 55,957,083 (GRCm39) I266L probably benign Het
Rft1 C T 14: 30,398,812 (GRCm39) R261W probably damaging Het
Rsrc1 C T 3: 67,197,680 (GRCm39) A195V probably damaging Het
Rtkn2 T G 10: 67,871,677 (GRCm39) L355R possibly damaging Het
Runx1t1 A T 4: 13,875,477 (GRCm39) D427V possibly damaging Het
Slc15a4 T G 5: 127,673,812 (GRCm39) H534P probably benign Het
Slc16a7 T C 10: 125,066,880 (GRCm39) N253S probably damaging Het
Slc29a1 A G 17: 45,897,063 (GRCm39) S408P probably damaging Het
Slc52a2 G A 15: 76,424,406 (GRCm39) A215T probably damaging Het
Smc1b T A 15: 85,011,995 (GRCm39) I126L probably damaging Het
Sycp2 A T 2: 178,023,650 (GRCm39) N455K probably benign Het
Tbck T C 3: 132,543,738 (GRCm39) V863A probably benign Het
Tfap2c A G 2: 172,395,347 (GRCm39) M263V probably benign Het
Tmem45a A G 16: 56,627,134 (GRCm39) V245A probably damaging Het
Top2a C T 11: 98,897,790 (GRCm39) G759D probably damaging Het
Traf5 A G 1: 191,729,489 (GRCm39) S218P Het
Tsfm T C 10: 126,866,502 (GRCm39) R20G probably benign Het
Ugt2a2 G T 5: 87,608,382 (GRCm39) Q486K probably damaging Het
Usp34 T A 11: 23,422,951 (GRCm39) D3108E Het
Wnt11 A G 7: 98,495,796 (GRCm39) Y100C probably damaging Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38,367,960 (GRCm39) critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38,358,204 (GRCm39) missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38,373,820 (GRCm39) missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38,358,174 (GRCm39) missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38,371,263 (GRCm39) missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38,358,018 (GRCm39) missense probably damaging 1.00
R1200:Zbtb49 UTSW 5 38,370,675 (GRCm39) missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38,371,038 (GRCm39) missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38,361,105 (GRCm39) nonsense probably null
R2155:Zbtb49 UTSW 5 38,371,464 (GRCm39) missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38,360,701 (GRCm39) intron probably benign
R3617:Zbtb49 UTSW 5 38,357,975 (GRCm39) unclassified probably benign
R4937:Zbtb49 UTSW 5 38,371,307 (GRCm39) missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38,358,160 (GRCm39) missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38,373,870 (GRCm39) missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38,360,903 (GRCm39) missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38,360,431 (GRCm39) splice site probably null
R6735:Zbtb49 UTSW 5 38,358,402 (GRCm39) missense possibly damaging 0.74
R6805:Zbtb49 UTSW 5 38,370,585 (GRCm39) intron probably benign
R6869:Zbtb49 UTSW 5 38,371,694 (GRCm39) missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38,370,711 (GRCm39) nonsense probably null
R7899:Zbtb49 UTSW 5 38,371,274 (GRCm39) nonsense probably null
R8041:Zbtb49 UTSW 5 38,358,198 (GRCm39) missense possibly damaging 0.61
R8461:Zbtb49 UTSW 5 38,358,453 (GRCm39) missense probably benign 0.04
R8517:Zbtb49 UTSW 5 38,357,997 (GRCm39) missense probably benign 0.25
R8523:Zbtb49 UTSW 5 38,370,669 (GRCm39) missense probably damaging 1.00
R9068:Zbtb49 UTSW 5 38,358,289 (GRCm39) missense probably benign
R9160:Zbtb49 UTSW 5 38,363,246 (GRCm39) missense probably damaging 0.99
R9315:Zbtb49 UTSW 5 38,358,082 (GRCm39) missense probably benign 0.05
R9480:Zbtb49 UTSW 5 38,358,409 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GTGTTTAAAAGGCTTCCCACAC -3'
(R):5'- TGGAGACTCCAGAGCACTTG -3'

Sequencing Primer
(F):5'- CACATGCATACTGTTTCTGGGGC -3'
(R):5'- AGACTCCAGAGCACTTGCCTTC -3'
Posted On 2022-03-25