Incidental Mutation 'R9301:Ovch2'
ID 704943
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms 9230106D23Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107380751-107400386 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107395815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 68 (S68P)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: S68P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: S68P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,881,128 (GRCm39) N514K probably benign Het
Adss1 A T 12: 112,602,882 (GRCm39) R358W probably damaging Het
Anxa8 T A 14: 33,819,932 (GRCm39) I307N probably damaging Het
Atad5 T A 11: 79,986,845 (GRCm39) I644N probably damaging Het
Atp5f1a G T 18: 77,868,938 (GRCm39) L437F probably damaging Het
Babam1 A G 8: 71,855,684 (GRCm39) K259R possibly damaging Het
BC048562 T G 9: 108,323,054 (GRCm39) F130V probably damaging Het
Btf3l4b T A 13: 96,217,621 (GRCm39) K73* probably null Het
Camsap2 T A 1: 136,202,640 (GRCm39) probably null Het
Ccne2 A G 4: 11,192,881 (GRCm39) I27M probably benign Het
Cd302 A G 2: 60,082,793 (GRCm39) V177A possibly damaging Het
Cfap46 T C 7: 139,222,461 (GRCm39) K1172R Het
Cic T C 7: 24,991,117 (GRCm39) W2141R probably damaging Het
Cpeb3 A G 19: 37,151,473 (GRCm39) V301A possibly damaging Het
Cpsf3 A G 12: 21,350,112 (GRCm39) K277R possibly damaging Het
Cstl1 A G 2: 148,592,926 (GRCm39) H27R possibly damaging Het
Dapk1 T A 13: 60,866,125 (GRCm39) I188K possibly damaging Het
Dock6 T C 9: 21,729,111 (GRCm39) T1301A probably benign Het
Eml5 A T 12: 98,848,292 (GRCm39) C133* probably null Het
Ermap T A 4: 119,042,744 (GRCm39) I260F probably damaging Het
Fbxw22 T G 9: 109,215,653 (GRCm39) E198D possibly damaging Het
Flt4 T C 11: 49,516,241 (GRCm39) Y115H possibly damaging Het
Fmo9 A C 1: 166,494,794 (GRCm39) I369S probably damaging Het
Frmd4a T A 2: 4,157,904 (GRCm39) S6T probably benign Het
Golga5 A T 12: 102,443,057 (GRCm39) I330L probably benign Het
Helq C A 5: 100,927,158 (GRCm39) V643F probably damaging Het
Ino80d A T 1: 63,104,969 (GRCm39) L369H probably damaging Het
Kank1 A T 19: 25,388,798 (GRCm39) M824L probably benign Het
Lilrb4b T C 10: 51,356,801 (GRCm39) probably benign Het
Ltbp4 T A 7: 27,021,578 (GRCm39) D1003V probably damaging Het
Mapk8ip2 T C 15: 89,341,886 (GRCm39) S366P probably damaging Het
Mdga1 T C 17: 30,069,512 (GRCm39) H178R probably benign Het
Mlh3 A G 12: 85,292,613 (GRCm39) V1266A possibly damaging Het
Nrp1 A G 8: 129,089,859 (GRCm39) E78G probably damaging Het
Or1l4 A T 2: 37,091,255 (GRCm39) M1L probably benign Het
Or4z4 A T 19: 12,076,826 (GRCm39) M59K probably damaging Het
Or5d16 A G 2: 87,773,297 (GRCm39) V225A probably benign Het
Or8k33 A G 2: 86,383,818 (GRCm39) S217P possibly damaging Het
Pappa2 T A 1: 158,672,614 (GRCm39) I1110F probably damaging Het
Pcyox1 A C 6: 86,369,241 (GRCm39) L195R possibly damaging Het
Pde11a A G 2: 75,848,217 (GRCm39) L870P probably damaging Het
Pgpep1 G A 8: 71,103,418 (GRCm39) T152M probably damaging Het
Pik3c2a A T 7: 115,945,413 (GRCm39) D1464E probably damaging Het
Plcb1 A G 2: 135,167,610 (GRCm39) K468R possibly damaging Het
Postn C T 3: 54,292,659 (GRCm39) T742I probably benign Het
Ppm1j T A 3: 104,691,057 (GRCm39) Y274N probably damaging Het
Ppp2cb T C 8: 34,090,038 (GRCm39) C32R possibly damaging Het
Prmt9 T A 8: 78,282,374 (GRCm39) Y90* probably null Het
Ptk2 T C 15: 73,146,346 (GRCm39) Y441C probably damaging Het
Rabggta T A 14: 55,957,083 (GRCm39) I266L probably benign Het
Rft1 C T 14: 30,398,812 (GRCm39) R261W probably damaging Het
Rsrc1 C T 3: 67,197,680 (GRCm39) A195V probably damaging Het
Rtkn2 T G 10: 67,871,677 (GRCm39) L355R possibly damaging Het
Runx1t1 A T 4: 13,875,477 (GRCm39) D427V possibly damaging Het
Slc15a4 T G 5: 127,673,812 (GRCm39) H534P probably benign Het
Slc16a7 T C 10: 125,066,880 (GRCm39) N253S probably damaging Het
Slc29a1 A G 17: 45,897,063 (GRCm39) S408P probably damaging Het
Slc52a2 G A 15: 76,424,406 (GRCm39) A215T probably damaging Het
Smc1b T A 15: 85,011,995 (GRCm39) I126L probably damaging Het
Sycp2 A T 2: 178,023,650 (GRCm39) N455K probably benign Het
Tbck T C 3: 132,543,738 (GRCm39) V863A probably benign Het
Tfap2c A G 2: 172,395,347 (GRCm39) M263V probably benign Het
Tmem45a A G 16: 56,627,134 (GRCm39) V245A probably damaging Het
Top2a C T 11: 98,897,790 (GRCm39) G759D probably damaging Het
Traf5 A G 1: 191,729,489 (GRCm39) S218P Het
Tsfm T C 10: 126,866,502 (GRCm39) R20G probably benign Het
Ugt2a2 G T 5: 87,608,382 (GRCm39) Q486K probably damaging Het
Usp34 T A 11: 23,422,951 (GRCm39) D3108E Het
Wnt11 A G 7: 98,495,796 (GRCm39) Y100C probably damaging Het
Zbtb49 A G 5: 38,370,931 (GRCm39) C317R probably benign Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107,388,297 (GRCm39) missense probably null 1.00
IGL02198:Ovch2 APN 7 107,394,041 (GRCm39) missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107,394,030 (GRCm39) missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107,395,755 (GRCm39) missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107,389,405 (GRCm39) missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107,394,138 (GRCm39) missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107,400,343 (GRCm39) missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107,381,243 (GRCm39) missense probably benign
R0631:Ovch2 UTSW 7 107,381,228 (GRCm39) missense probably benign 0.01
R1028:Ovch2 UTSW 7 107,395,755 (GRCm39) missense probably benign 0.37
R1329:Ovch2 UTSW 7 107,384,653 (GRCm39) missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107,389,412 (GRCm39) critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107,389,402 (GRCm39) missense probably benign 0.02
R2265:Ovch2 UTSW 7 107,383,782 (GRCm39) missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107,394,122 (GRCm39) missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107,384,699 (GRCm39) missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107,395,775 (GRCm39) missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107,395,755 (GRCm39) missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107,391,341 (GRCm39) missense probably benign 0.26
R5353:Ovch2 UTSW 7 107,393,631 (GRCm39) missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107,393,201 (GRCm39) missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107,392,606 (GRCm39) missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107,381,185 (GRCm39) missense probably benign
R5979:Ovch2 UTSW 7 107,393,595 (GRCm39) missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107,395,779 (GRCm39) missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107,384,648 (GRCm39) missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107,388,301 (GRCm39) missense probably benign 0.17
R6877:Ovch2 UTSW 7 107,389,315 (GRCm39) missense probably benign 0.25
R7040:Ovch2 UTSW 7 107,395,772 (GRCm39) missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107,393,640 (GRCm39) missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107,393,577 (GRCm39) missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107,388,295 (GRCm39) critical splice donor site probably null
R7841:Ovch2 UTSW 7 107,393,298 (GRCm39) missense probably benign 0.01
R7908:Ovch2 UTSW 7 107,388,326 (GRCm39) missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107,393,207 (GRCm39) missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107,389,584 (GRCm39) missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107,393,251 (GRCm39) nonsense probably null
R8812:Ovch2 UTSW 7 107,392,462 (GRCm39) missense probably damaging 1.00
R9250:Ovch2 UTSW 7 107,392,542 (GRCm39) missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107,389,560 (GRCm39) missense probably benign 0.03
R9703:Ovch2 UTSW 7 107,383,777 (GRCm39) missense probably damaging 1.00
R9717:Ovch2 UTSW 7 107,393,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGCCTCATTTGTGACACCC -3'
(R):5'- TGAAGTTGTAGGGGTCAAATAGTC -3'

Sequencing Primer
(F):5'- AGCCTCATTTGTGACACCCAATTATC -3'
(R):5'- GAGTCATGATCACTGTGG -3'
Posted On 2022-03-25