Incidental Mutation 'R9301:Cfap46'
ID 704945
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 139642545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1172 (K1172R)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]
AlphaFold E9Q2C0
Predicted Effect
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: K1172R

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140820
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000155075
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,087,479 N514K probably benign Het
Adssl1 A T 12: 112,636,448 R358W probably damaging Het
Anxa8 T A 14: 34,097,975 I307N probably damaging Het
Atad5 T A 11: 80,096,019 I644N probably damaging Het
Atp5a1 G T 18: 77,781,238 L437F probably damaging Het
Babam1 A G 8: 71,403,040 K259R possibly damaging Het
BC048562 T G 9: 108,445,855 F130V probably damaging Het
Camsap2 T A 1: 136,274,902 probably null Het
Ccne2 A G 4: 11,192,881 I27M probably benign Het
Cd302 A G 2: 60,252,449 V177A possibly damaging Het
Cic T C 7: 25,291,692 W2141R probably damaging Het
Cpeb3 A G 19: 37,174,073 V301A possibly damaging Het
Cpsf3 A G 12: 21,300,111 K277R possibly damaging Het
Cstl1 A G 2: 148,751,006 H27R possibly damaging Het
Dapk1 T A 13: 60,718,311 I188K possibly damaging Het
Dock6 T C 9: 21,817,815 T1301A probably benign Het
Eml5 A T 12: 98,882,033 C133* probably null Het
Ermap T A 4: 119,185,547 I260F probably damaging Het
Fbxw22 T G 9: 109,386,585 E198D possibly damaging Het
Flt4 T C 11: 49,625,414 Y115H possibly damaging Het
Fmo9 A C 1: 166,667,225 I369S probably damaging Het
Frmd4a T A 2: 4,153,093 S6T probably benign Het
Gm20075 T A 13: 96,081,113 K73* probably null Het
Golga5 A T 12: 102,476,798 I330L probably benign Het
Helq C A 5: 100,779,292 V643F probably damaging Het
Ino80d A T 1: 63,065,810 L369H probably damaging Het
Kank1 A T 19: 25,411,434 M824L probably benign Het
Lilr4b T C 10: 51,480,705 probably benign Het
Ltbp4 T A 7: 27,322,153 D1003V probably damaging Het
Mapk8ip2 T C 15: 89,457,683 S366P probably damaging Het
Mdga1 T C 17: 29,850,538 H178R probably benign Het
Mlh3 A G 12: 85,245,839 V1266A possibly damaging Het
Nrp1 A G 8: 128,363,378 E78G probably damaging Het
Olfr1080 A G 2: 86,553,474 S217P possibly damaging Het
Olfr1155 A G 2: 87,942,953 V225A probably benign Het
Olfr1427 A T 19: 12,099,462 M59K probably damaging Het
Olfr365 A T 2: 37,201,243 M1L probably benign Het
Ovch2 A G 7: 107,796,608 S68P probably damaging Het
Pappa2 T A 1: 158,845,044 I1110F probably damaging Het
Pcyox1 A C 6: 86,392,259 L195R possibly damaging Het
Pde11a A G 2: 76,017,873 L870P probably damaging Het
Pgpep1 G A 8: 70,650,768 T152M probably damaging Het
Pik3c2a A T 7: 116,346,178 D1464E probably damaging Het
Plcb1 A G 2: 135,325,690 K468R possibly damaging Het
Postn C T 3: 54,385,238 T742I probably benign Het
Ppm1j T A 3: 104,783,741 Y274N probably damaging Het
Ppp2cb T C 8: 33,600,010 C32R possibly damaging Het
Prmt9 T A 8: 77,555,745 Y90* probably null Het
Ptk2 T C 15: 73,274,497 Y441C probably damaging Het
Rabggta T A 14: 55,719,626 I266L probably benign Het
Rft1 C T 14: 30,676,855 R261W probably damaging Het
Rsrc1 C T 3: 67,290,347 A195V probably damaging Het
Rtkn2 T G 10: 68,035,847 L355R possibly damaging Het
Runx1t1 A T 4: 13,875,477 D427V possibly damaging Het
Slc15a4 T G 5: 127,596,748 H534P probably benign Het
Slc16a7 T C 10: 125,231,011 N253S probably damaging Het
Slc29a1 A G 17: 45,586,137 S408P probably damaging Het
Slc52a2 G A 15: 76,540,206 A215T probably damaging Het
Smc1b T A 15: 85,127,794 I126L probably damaging Het
Sycp2 A T 2: 178,381,857 N455K probably benign Het
Tbck T C 3: 132,837,977 V863A probably benign Het
Tfap2c A G 2: 172,553,427 M263V probably benign Het
Tmem45a A G 16: 56,806,771 V245A probably damaging Het
Top2a C T 11: 99,006,964 G759D probably damaging Het
Traf5 A G 1: 191,997,528 S218P Het
Tsfm T C 10: 127,030,633 R20G probably benign Het
Ugt2a2 G T 5: 87,460,523 Q486K probably damaging Het
Usp34 T A 11: 23,472,951 D3108E Het
Wnt11 A G 7: 98,846,589 Y100C probably damaging Het
Zbtb49 A G 5: 38,213,587 C317R probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9224:Cfap46 UTSW 7 139678500 nonsense probably null
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9402:Cfap46 UTSW 7 139635949 missense unknown
R9443:Cfap46 UTSW 7 139615107 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGTGACATCCTCTGAGCTG -3'
(R):5'- AGCCAGGTCCCTATCTTGTC -3'

Sequencing Primer
(F):5'- TCTGAGCTGACCCACGAAG -3'
(R):5'- TGTCCCATCCCTGCCAACAG -3'
Posted On 2022-03-25