Incidental Mutation 'R9301:Slc16a7'
ID 704956
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, MCT2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R9301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 125219270-125389465 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125231011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 253 (N253S)
Ref Sequence ENSEMBL: ENSMUSP00000065433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably damaging
Transcript: ENSMUST00000063318
AA Change: N253S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: N253S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105257
AA Change: N253S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: N253S

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210780
AA Change: N253S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000211781
AA Change: N253S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,087,479 N514K probably benign Het
Adssl1 A T 12: 112,636,448 R358W probably damaging Het
Anxa8 T A 14: 34,097,975 I307N probably damaging Het
Atad5 T A 11: 80,096,019 I644N probably damaging Het
Atp5a1 G T 18: 77,781,238 L437F probably damaging Het
Babam1 A G 8: 71,403,040 K259R possibly damaging Het
BC048562 T G 9: 108,445,855 F130V probably damaging Het
Camsap2 T A 1: 136,274,902 probably null Het
Ccne2 A G 4: 11,192,881 I27M probably benign Het
Cd302 A G 2: 60,252,449 V177A possibly damaging Het
Cfap46 T C 7: 139,642,545 K1172R Het
Cic T C 7: 25,291,692 W2141R probably damaging Het
Cpeb3 A G 19: 37,174,073 V301A possibly damaging Het
Cpsf3 A G 12: 21,300,111 K277R possibly damaging Het
Cstl1 A G 2: 148,751,006 H27R possibly damaging Het
Dapk1 T A 13: 60,718,311 I188K possibly damaging Het
Dock6 T C 9: 21,817,815 T1301A probably benign Het
Eml5 A T 12: 98,882,033 C133* probably null Het
Ermap T A 4: 119,185,547 I260F probably damaging Het
Fbxw22 T G 9: 109,386,585 E198D possibly damaging Het
Flt4 T C 11: 49,625,414 Y115H possibly damaging Het
Fmo9 A C 1: 166,667,225 I369S probably damaging Het
Frmd4a T A 2: 4,153,093 S6T probably benign Het
Gm20075 T A 13: 96,081,113 K73* probably null Het
Golga5 A T 12: 102,476,798 I330L probably benign Het
Helq C A 5: 100,779,292 V643F probably damaging Het
Ino80d A T 1: 63,065,810 L369H probably damaging Het
Kank1 A T 19: 25,411,434 M824L probably benign Het
Lilr4b T C 10: 51,480,705 probably benign Het
Ltbp4 T A 7: 27,322,153 D1003V probably damaging Het
Mapk8ip2 T C 15: 89,457,683 S366P probably damaging Het
Mdga1 T C 17: 29,850,538 H178R probably benign Het
Mlh3 A G 12: 85,245,839 V1266A possibly damaging Het
Nrp1 A G 8: 128,363,378 E78G probably damaging Het
Olfr1080 A G 2: 86,553,474 S217P possibly damaging Het
Olfr1155 A G 2: 87,942,953 V225A probably benign Het
Olfr1427 A T 19: 12,099,462 M59K probably damaging Het
Olfr365 A T 2: 37,201,243 M1L probably benign Het
Ovch2 A G 7: 107,796,608 S68P probably damaging Het
Pappa2 T A 1: 158,845,044 I1110F probably damaging Het
Pcyox1 A C 6: 86,392,259 L195R possibly damaging Het
Pde11a A G 2: 76,017,873 L870P probably damaging Het
Pgpep1 G A 8: 70,650,768 T152M probably damaging Het
Pik3c2a A T 7: 116,346,178 D1464E probably damaging Het
Plcb1 A G 2: 135,325,690 K468R possibly damaging Het
Postn C T 3: 54,385,238 T742I probably benign Het
Ppm1j T A 3: 104,783,741 Y274N probably damaging Het
Ppp2cb T C 8: 33,600,010 C32R possibly damaging Het
Prmt9 T A 8: 77,555,745 Y90* probably null Het
Ptk2 T C 15: 73,274,497 Y441C probably damaging Het
Rabggta T A 14: 55,719,626 I266L probably benign Het
Rft1 C T 14: 30,676,855 R261W probably damaging Het
Rsrc1 C T 3: 67,290,347 A195V probably damaging Het
Rtkn2 T G 10: 68,035,847 L355R possibly damaging Het
Runx1t1 A T 4: 13,875,477 D427V possibly damaging Het
Slc15a4 T G 5: 127,596,748 H534P probably benign Het
Slc29a1 A G 17: 45,586,137 S408P probably damaging Het
Slc52a2 G A 15: 76,540,206 A215T probably damaging Het
Smc1b T A 15: 85,127,794 I126L probably damaging Het
Sycp2 A T 2: 178,381,857 N455K probably benign Het
Tbck T C 3: 132,837,977 V863A probably benign Het
Tfap2c A G 2: 172,553,427 M263V probably benign Het
Tmem45a A G 16: 56,806,771 V245A probably damaging Het
Top2a C T 11: 99,006,964 G759D probably damaging Het
Traf5 A G 1: 191,997,528 S218P Het
Tsfm T C 10: 127,030,633 R20G probably benign Het
Ugt2a2 G T 5: 87,460,523 Q486K probably damaging Het
Usp34 T A 11: 23,472,951 D3108E Het
Wnt11 A G 7: 98,846,589 Y100C probably damaging Het
Zbtb49 A G 5: 38,213,587 C317R probably benign Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125230934 missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125230798 missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125230933 missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125230691 missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125228082 missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125228070 missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125294631 missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125230873 missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125233501 missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125231147 missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125231372 missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125230620 nonsense probably null
R1554:Slc16a7 UTSW 10 125230922 missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125231198 missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125294700 nonsense probably null
R3546:Slc16a7 UTSW 10 125294700 nonsense probably null
R3547:Slc16a7 UTSW 10 125294700 nonsense probably null
R3934:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125228187 missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125233439 splice site probably null
R4513:Slc16a7 UTSW 10 125233439 splice site probably null
R4514:Slc16a7 UTSW 10 125233439 splice site probably null
R5157:Slc16a7 UTSW 10 125233464 nonsense probably null
R5247:Slc16a7 UTSW 10 125231314 missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125294604 missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125228215 missense probably benign
R6263:Slc16a7 UTSW 10 125294639 missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125231018 missense probably damaging 0.97
R7450:Slc16a7 UTSW 10 125228051 missense probably benign 0.00
R7680:Slc16a7 UTSW 10 125230936 missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125328333 critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125230667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCTGAGTAGGTAGTTGCTAG -3'
(R):5'- ATGAGACCTGTTGGGCCAAG -3'

Sequencing Primer
(F):5'- GCATATGCCAGTAAAGATGATTGC -3'
(R):5'- TGTTGGGCCAAGTCCAAATAC -3'
Posted On 2022-03-25