Incidental Mutation 'R0737:Garnl3'
ID70496
Institutional Source Beutler Lab
Gene Symbol Garnl3
Ensembl Gene ENSMUSG00000038860
Gene NameGTPase activating RANGAP domain-like 3
Synonyms
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location32986224-33131654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32990642 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 868 (I868F)
Ref Sequence ENSEMBL: ENSMUSP00000099874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]
Predicted Effect probably damaging
Transcript: ENSMUST00000049618
AA Change: I872F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: I872F

DomainStartEndE-ValueType
Pfam:Rap_GAP 202 383 3.4e-73 PFAM
Pfam:CNH 475 780 3.5e-67 PFAM
low complexity region 793 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102810
AA Change: I868F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: I868F

DomainStartEndE-ValueType
Pfam:Rap_GAP 198 385 4.6e-67 PFAM
Pfam:CNH 471 776 1.8e-68 PFAM
low complexity region 789 800 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137381
AA Change: I913F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Garnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Garnl3 APN 2 33006816 missense probably damaging 1.00
IGL01601:Garnl3 APN 2 32997689 nonsense probably null
IGL01981:Garnl3 APN 2 32997729 missense probably damaging 0.98
IGL02209:Garnl3 APN 2 33085930 missense probably damaging 0.99
IGL02434:Garnl3 APN 2 33054205 missense probably damaging 1.00
IGL02512:Garnl3 APN 2 33031138 missense probably damaging 1.00
IGL02947:Garnl3 APN 2 33046594 missense probably damaging 1.00
PIT4403001:Garnl3 UTSW 2 32990758 missense probably damaging 1.00
R0123:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0134:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0225:Garnl3 UTSW 2 33006804 missense possibly damaging 0.92
R0551:Garnl3 UTSW 2 33016738 missense probably damaging 1.00
R0691:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R0693:Garnl3 UTSW 2 33085907 missense probably damaging 1.00
R1350:Garnl3 UTSW 2 33052214 missense probably damaging 1.00
R1691:Garnl3 UTSW 2 32997663 nonsense probably null
R1791:Garnl3 UTSW 2 33034127 missense probably benign 0.02
R1938:Garnl3 UTSW 2 33005200 missense probably damaging 0.99
R2100:Garnl3 UTSW 2 33046645 missense probably benign 0.35
R2316:Garnl3 UTSW 2 33005152 missense probably damaging 1.00
R2353:Garnl3 UTSW 2 33064034 missense probably damaging 1.00
R3161:Garnl3 UTSW 2 33034711 missense probably damaging 1.00
R3839:Garnl3 UTSW 2 32989546 missense probably benign 0.00
R3847:Garnl3 UTSW 2 32992228 missense probably benign
R4871:Garnl3 UTSW 2 33087088 start codon destroyed probably null 0.77
R5682:Garnl3 UTSW 2 33054173 missense probably damaging 1.00
R5811:Garnl3 UTSW 2 33006899 missense probably damaging 0.99
R6267:Garnl3 UTSW 2 33104880 missense probably benign 0.20
R6502:Garnl3 UTSW 2 33006821 missense possibly damaging 0.67
R6532:Garnl3 UTSW 2 33031119 missense possibly damaging 0.87
R6639:Garnl3 UTSW 2 32989525 missense possibly damaging 0.75
R6763:Garnl3 UTSW 2 33054196 missense probably damaging 1.00
R6866:Garnl3 UTSW 2 33002773 splice site probably null
R6913:Garnl3 UTSW 2 32986829 missense possibly damaging 0.91
R7002:Garnl3 UTSW 2 33054193 missense possibly damaging 0.65
R7168:Garnl3 UTSW 2 32995078 missense probably damaging 1.00
R7341:Garnl3 UTSW 2 33034129 missense probably damaging 1.00
R7746:Garnl3 UTSW 2 32992257 missense probably damaging 1.00
R7919:Garnl3 UTSW 2 33046599 missense probably benign 0.38
R8079:Garnl3 UTSW 2 33018499 critical splice donor site probably null
R8087:Garnl3 UTSW 2 33045536 missense probably benign 0.01
R8123:Garnl3 UTSW 2 33104938 missense probably damaging 0.97
R8170:Garnl3 UTSW 2 33015223 missense possibly damaging 0.88
R8347:Garnl3 UTSW 2 33085891 missense probably damaging 1.00
R8418:Garnl3 UTSW 2 33052146 missense possibly damaging 0.73
R8679:Garnl3 UTSW 2 33026094 missense probably damaging 1.00
R8940:Garnl3 UTSW 2 33005229 critical splice acceptor site probably null
X0022:Garnl3 UTSW 2 33022668 missense probably damaging 1.00
X0023:Garnl3 UTSW 2 33026149 missense probably damaging 1.00
X0024:Garnl3 UTSW 2 33005179 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGGGAAATGGTACAGTATTCTCTGGTG -3'
(R):5'- TGAGCCTAAAGTTCTGGTCTTTTCCGA -3'

Sequencing Primer
(F):5'- agccctctctccagccc -3'
(R):5'- CGAATTGTGTTTCAGGTGAAATTCAG -3'
Posted On2013-09-30