Mutagenetix > Incidental Mutation

Incidental Mutation 'R0737:Garnl3'

70496

Institutional Source

Beutler Lab

Gene Symbol

Garnl3

Ensembl Gene

ENSMUSG00000038860

Gene Name

GTPase activating RANGAP domain-like 3

Synonyms

MMRRC Submission

038918-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R0737 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32986224-33131654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32990642 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 868 (I868F)

Ref Sequence

ENSEMBL: ENSMUSP00000099874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049618] [ENSMUST00000102810] [ENSMUST00000137381]

AlphaFold

Q3V0G7

Predicted Effect

probably damaging
Transcript: ENSMUST00000049618
AA Change: I872F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000057582
Gene: ENSMUSG00000038860
AA Change: I872F

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	202	383	3.4e-73	PFAM
Pfam:CNH	475	780	3.5e-67	PFAM
low complexity region	793	804	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102810
AA Change: I868F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099874
Gene: ENSMUSG00000038860
AA Change: I868F

Domain	Start	End	E-Value	Type
Pfam:Rap_GAP	198	385	4.6e-67	PFAM
Pfam:CNH	471	776	1.8e-68	PFAM
low complexity region	789	800	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000137381
AA Change: I913F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	T	A	X: 70,394,207		probably benign	Het
4932429P05Rik	A	G	X: 89,754,320	H586R	probably benign	Het
9130409I23Rik	G	A	1: 181,055,379	M235I	probably benign	Het
Aff4	T	A	11: 53,410,953	L1043*	probably null	Het
Ankrd11	G	T	8: 122,895,836	R426S	probably damaging	Het
Atm	T	A	9: 53,456,566	N2422I	probably damaging	Het
Bahcc1	C	A	11: 120,272,841	P655Q	probably damaging	Het
Baz2a	A	G	10: 128,116,080	I556V	possibly damaging	Het
BC017643	C	T	11: 121,227,242		probably null	Het
Ccdc33	T	C	9: 58,082,048	D114G	probably damaging	Het
Cdk5rap2	T	C	4: 70,337,375	H424R	probably benign	Het
Cfap57	T	C	4: 118,581,102	E864G	possibly damaging	Het
Cit	T	A	5: 115,946,919	S836R	probably damaging	Het
Clip4	C	T	17: 71,837,699	Q95*	probably null	Het
Col17a1	C	T	19: 47,669,433	G433S	possibly damaging	Het
Col6a3	A	G	1: 90,828,298	F90L	probably damaging	Het
Dnah9	T	C	11: 66,107,898	H1108R	probably damaging	Het
Elac1	A	T	18: 73,739,039	M295K	probably damaging	Het
Epas1	G	T	17: 86,829,456	G816C	possibly damaging	Het
Ermap	C	A	4: 119,178,510	C427F	probably damaging	Het
Fbxo44	T	C	4: 148,158,809		probably benign	Het
Fmo4	T	A	1: 162,808,392	K14*	probably null	Het
Gadl1	G	A	9: 116,073,987	M461I	probably damaging	Het
Gm6614	G	T	6: 142,003,428	A74E	possibly damaging	Het
Gm7168	A	G	17: 13,948,983	D204G	probably damaging	Het
Hs6st3	T	C	14: 119,869,383	F401S	possibly damaging	Het
Kcnmb1	A	T	11: 33,964,701	M1L	probably benign	Het
Krt35	T	C	11: 100,093,794	T292A	probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lamb2	T	A	9: 108,483,794	W572R	probably benign	Het
Letmd1	A	G	15: 100,469,821	T87A	probably damaging	Het
Lrp2	A	G	2: 69,448,169	Y3947H	probably damaging	Het
Mocos	T	C	18: 24,688,987	F685L	probably damaging	Het
Nsun6	A	T	2: 14,996,474	F424I	probably damaging	Het
Nup88	A	G	11: 70,969,950	M1T	probably null	Het
Olfr1209	T	C	2: 88,910,273	N40S	probably damaging	Het
Olfr1339	C	T	4: 118,735,224	R232C	probably benign	Het
Olfr297	C	T	7: 86,526,987	P77S	probably damaging	Het
Pcdhb12	T	A	18: 37,437,709	V636D	probably damaging	Het
Pclo	C	A	5: 14,515,439	A73E	probably damaging	Het
Pdlim7	A	T	13: 55,504,880		probably null	Het
Phldb1	G	A	9: 44,699,636	P67S	possibly damaging	Het
Ppp2r2b	T	C	18: 43,059,192	T17A	probably benign	Het
Rab11fip4	T	C	11: 79,683,502	V241A	probably benign	Het
Slc41a1	T	C	1: 131,840,952	L216P	probably damaging	Het
Smg6	T	A	11: 75,159,836	D1352E	probably damaging	Het
Tbc1d9	A	T	8: 83,259,313	I816F	probably damaging	Het
Tex264	T	C	9: 106,659,299	T220A	probably benign	Het
Tmco6	G	A	18: 36,741,776	V439I	probably damaging	Het
Tmem64	A	G	4: 15,266,717	I256V	probably damaging	Het
Tnks1bp1	A	G	2: 85,052,536	S236G	possibly damaging	Het
Tsc1	A	G	2: 28,670,930	T267A	possibly damaging	Het
Txndc2	A	G	17: 65,639,553		probably null	Het
Vmn2r94	G	A	17: 18,277,433	Q26*	probably null	Het
Zan	T	C	5: 137,389,249	D4900G	unknown	Het
Zkscan3	T	C	13: 21,388,596	T122A	probably benign	Het

Other mutations in Garnl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Garnl3	APN	2	33006816	missense	probably damaging	1.00
IGL01601:Garnl3	APN	2	32997689	nonsense	probably null
IGL01981:Garnl3	APN	2	32997729	missense	probably damaging	0.98
IGL02209:Garnl3	APN	2	33085930	missense	probably damaging	0.99
IGL02434:Garnl3	APN	2	33054205	missense	probably damaging	1.00
IGL02512:Garnl3	APN	2	33031138	missense	probably damaging	1.00
IGL02947:Garnl3	APN	2	33046594	missense	probably damaging	1.00
PIT4403001:Garnl3	UTSW	2	32990758	missense	probably damaging	1.00
R0123:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0134:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0225:Garnl3	UTSW	2	33006804	missense	possibly damaging	0.92
R0551:Garnl3	UTSW	2	33016738	missense	probably damaging	1.00
R0691:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R0693:Garnl3	UTSW	2	33085907	missense	probably damaging	1.00
R1350:Garnl3	UTSW	2	33052214	missense	probably damaging	1.00
R1691:Garnl3	UTSW	2	32997663	nonsense	probably null
R1791:Garnl3	UTSW	2	33034127	missense	probably benign	0.02
R1938:Garnl3	UTSW	2	33005200	missense	probably damaging	0.99
R2100:Garnl3	UTSW	2	33046645	missense	probably benign	0.35
R2316:Garnl3	UTSW	2	33005152	missense	probably damaging	1.00
R2353:Garnl3	UTSW	2	33064034	missense	probably damaging	1.00
R3161:Garnl3	UTSW	2	33034711	missense	probably damaging	1.00
R3839:Garnl3	UTSW	2	32989546	missense	probably benign	0.00
R3847:Garnl3	UTSW	2	32992228	missense	probably benign
R4871:Garnl3	UTSW	2	33087088	start codon destroyed	probably null	0.77
R5682:Garnl3	UTSW	2	33054173	missense	probably damaging	1.00
R5811:Garnl3	UTSW	2	33006899	missense	probably damaging	0.99
R6267:Garnl3	UTSW	2	33104880	missense	probably benign	0.20
R6502:Garnl3	UTSW	2	33006821	missense	possibly damaging	0.67
R6532:Garnl3	UTSW	2	33031119	missense	possibly damaging	0.87
R6639:Garnl3	UTSW	2	32989525	missense	possibly damaging	0.75
R6763:Garnl3	UTSW	2	33054196	missense	probably damaging	1.00
R6866:Garnl3	UTSW	2	33002773	splice site	probably null
R6913:Garnl3	UTSW	2	32986829	missense	possibly damaging	0.91
R7002:Garnl3	UTSW	2	33054193	missense	possibly damaging	0.65
R7168:Garnl3	UTSW	2	32995078	missense	probably damaging	1.00
R7341:Garnl3	UTSW	2	33034129	missense	probably damaging	1.00
R7746:Garnl3	UTSW	2	32992257	missense	probably damaging	1.00
R7919:Garnl3	UTSW	2	33046599	missense	probably benign	0.38
R8079:Garnl3	UTSW	2	33018499	critical splice donor site	probably null
R8087:Garnl3	UTSW	2	33045536	missense	probably benign	0.01
R8123:Garnl3	UTSW	2	33104938	missense	probably damaging	0.97
R8170:Garnl3	UTSW	2	33015223	missense	possibly damaging	0.88
R8347:Garnl3	UTSW	2	33085891	missense	probably damaging	1.00
R8418:Garnl3	UTSW	2	33052146	missense	possibly damaging	0.73
R8679:Garnl3	UTSW	2	33026094	missense	probably damaging	1.00
R8940:Garnl3	UTSW	2	33005229	critical splice acceptor site	probably null
R9081:Garnl3	UTSW	2	33006908	missense	possibly damaging	0.90
R9183:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9213:Garnl3	UTSW	2	33005068	missense	probably damaging	1.00
R9219:Garnl3	UTSW	2	33085886	missense	probably damaging	1.00
R9453:Garnl3	UTSW	2	33003869	missense	probably damaging	1.00
X0022:Garnl3	UTSW	2	33022668	missense	probably damaging	1.00
X0023:Garnl3	UTSW	2	33026149	missense	probably damaging	1.00
X0024:Garnl3	UTSW	2	33005179	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTGGGAAATGGTACAGTATTCTCTGGTG -3'
(R):5'- TGAGCCTAAAGTTCTGGTCTTTTCCGA -3'

Sequencing Primer
(F):5'- agccctctctccagccc -3'
(R):5'- CGAATTGTGTTTCAGGTGAAATTCAG -3'

Posted On

2013-09-30