Incidental Mutation 'R9301:Atad5'
ID 704960
Institutional Source Beutler Lab
Gene Symbol Atad5
Ensembl Gene ENSMUSG00000017550
Gene Name ATPase family, AAA domain containing 5
Synonyms LOC237877, C130052G03Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 79980226-80026620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79986845 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 644 (I644N)
Ref Sequence ENSEMBL: ENSMUSP00000017694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017694] [ENSMUST00000108239]
AlphaFold Q4QY64
Predicted Effect probably damaging
Transcript: ENSMUST00000017694
AA Change: I644N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017694
Gene: ENSMUSG00000017550
AA Change: I644N

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1111 1347 5.14e-5 SMART
Blast:AAA 1409 1526 1e-31 BLAST
low complexity region 1573 1583 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108239
AA Change: I644N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103874
Gene: ENSMUSG00000017550
AA Change: I644N

DomainStartEndE-ValueType
low complexity region 298 311 N/A INTRINSIC
low complexity region 327 342 N/A INTRINSIC
low complexity region 467 486 N/A INTRINSIC
coiled coil region 665 697 N/A INTRINSIC
low complexity region 798 807 N/A INTRINSIC
AAA 1108 1344 5.14e-5 SMART
Blast:AAA 1406 1523 1e-31 BLAST
low complexity region 1570 1580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for a gene trap allele exhibit genomic instability, premature death, and a wide spectrum of spontaneous tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,881,128 (GRCm39) N514K probably benign Het
Adss1 A T 12: 112,602,882 (GRCm39) R358W probably damaging Het
Anxa8 T A 14: 33,819,932 (GRCm39) I307N probably damaging Het
Atp5f1a G T 18: 77,868,938 (GRCm39) L437F probably damaging Het
Babam1 A G 8: 71,855,684 (GRCm39) K259R possibly damaging Het
BC048562 T G 9: 108,323,054 (GRCm39) F130V probably damaging Het
Btf3l4b T A 13: 96,217,621 (GRCm39) K73* probably null Het
Camsap2 T A 1: 136,202,640 (GRCm39) probably null Het
Ccne2 A G 4: 11,192,881 (GRCm39) I27M probably benign Het
Cd302 A G 2: 60,082,793 (GRCm39) V177A possibly damaging Het
Cfap46 T C 7: 139,222,461 (GRCm39) K1172R Het
Cic T C 7: 24,991,117 (GRCm39) W2141R probably damaging Het
Cpeb3 A G 19: 37,151,473 (GRCm39) V301A possibly damaging Het
Cpsf3 A G 12: 21,350,112 (GRCm39) K277R possibly damaging Het
Cstl1 A G 2: 148,592,926 (GRCm39) H27R possibly damaging Het
Dapk1 T A 13: 60,866,125 (GRCm39) I188K possibly damaging Het
Dock6 T C 9: 21,729,111 (GRCm39) T1301A probably benign Het
Eml5 A T 12: 98,848,292 (GRCm39) C133* probably null Het
Ermap T A 4: 119,042,744 (GRCm39) I260F probably damaging Het
Fbxw22 T G 9: 109,215,653 (GRCm39) E198D possibly damaging Het
Flt4 T C 11: 49,516,241 (GRCm39) Y115H possibly damaging Het
Fmo9 A C 1: 166,494,794 (GRCm39) I369S probably damaging Het
Frmd4a T A 2: 4,157,904 (GRCm39) S6T probably benign Het
Golga5 A T 12: 102,443,057 (GRCm39) I330L probably benign Het
Helq C A 5: 100,927,158 (GRCm39) V643F probably damaging Het
Ino80d A T 1: 63,104,969 (GRCm39) L369H probably damaging Het
Kank1 A T 19: 25,388,798 (GRCm39) M824L probably benign Het
Lilrb4b T C 10: 51,356,801 (GRCm39) probably benign Het
Ltbp4 T A 7: 27,021,578 (GRCm39) D1003V probably damaging Het
Mapk8ip2 T C 15: 89,341,886 (GRCm39) S366P probably damaging Het
Mdga1 T C 17: 30,069,512 (GRCm39) H178R probably benign Het
Mlh3 A G 12: 85,292,613 (GRCm39) V1266A possibly damaging Het
Nrp1 A G 8: 129,089,859 (GRCm39) E78G probably damaging Het
Or1l4 A T 2: 37,091,255 (GRCm39) M1L probably benign Het
Or4z4 A T 19: 12,076,826 (GRCm39) M59K probably damaging Het
Or5d16 A G 2: 87,773,297 (GRCm39) V225A probably benign Het
Or8k33 A G 2: 86,383,818 (GRCm39) S217P possibly damaging Het
Ovch2 A G 7: 107,395,815 (GRCm39) S68P probably damaging Het
Pappa2 T A 1: 158,672,614 (GRCm39) I1110F probably damaging Het
Pcyox1 A C 6: 86,369,241 (GRCm39) L195R possibly damaging Het
Pde11a A G 2: 75,848,217 (GRCm39) L870P probably damaging Het
Pgpep1 G A 8: 71,103,418 (GRCm39) T152M probably damaging Het
Pik3c2a A T 7: 115,945,413 (GRCm39) D1464E probably damaging Het
Plcb1 A G 2: 135,167,610 (GRCm39) K468R possibly damaging Het
Postn C T 3: 54,292,659 (GRCm39) T742I probably benign Het
Ppm1j T A 3: 104,691,057 (GRCm39) Y274N probably damaging Het
Ppp2cb T C 8: 34,090,038 (GRCm39) C32R possibly damaging Het
Prmt9 T A 8: 78,282,374 (GRCm39) Y90* probably null Het
Ptk2 T C 15: 73,146,346 (GRCm39) Y441C probably damaging Het
Rabggta T A 14: 55,957,083 (GRCm39) I266L probably benign Het
Rft1 C T 14: 30,398,812 (GRCm39) R261W probably damaging Het
Rsrc1 C T 3: 67,197,680 (GRCm39) A195V probably damaging Het
Rtkn2 T G 10: 67,871,677 (GRCm39) L355R possibly damaging Het
Runx1t1 A T 4: 13,875,477 (GRCm39) D427V possibly damaging Het
Slc15a4 T G 5: 127,673,812 (GRCm39) H534P probably benign Het
Slc16a7 T C 10: 125,066,880 (GRCm39) N253S probably damaging Het
Slc29a1 A G 17: 45,897,063 (GRCm39) S408P probably damaging Het
Slc52a2 G A 15: 76,424,406 (GRCm39) A215T probably damaging Het
Smc1b T A 15: 85,011,995 (GRCm39) I126L probably damaging Het
Sycp2 A T 2: 178,023,650 (GRCm39) N455K probably benign Het
Tbck T C 3: 132,543,738 (GRCm39) V863A probably benign Het
Tfap2c A G 2: 172,395,347 (GRCm39) M263V probably benign Het
Tmem45a A G 16: 56,627,134 (GRCm39) V245A probably damaging Het
Top2a C T 11: 98,897,790 (GRCm39) G759D probably damaging Het
Traf5 A G 1: 191,729,489 (GRCm39) S218P Het
Tsfm T C 10: 126,866,502 (GRCm39) R20G probably benign Het
Ugt2a2 G T 5: 87,608,382 (GRCm39) Q486K probably damaging Het
Usp34 T A 11: 23,422,951 (GRCm39) D3108E Het
Wnt11 A G 7: 98,495,796 (GRCm39) Y100C probably damaging Het
Zbtb49 A G 5: 38,370,931 (GRCm39) C317R probably benign Het
Other mutations in Atad5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Atad5 APN 11 80,023,684 (GRCm39) missense probably benign 0.22
IGL00916:Atad5 APN 11 80,009,826 (GRCm39) missense probably damaging 1.00
IGL01348:Atad5 APN 11 79,986,390 (GRCm39) missense probably benign 0.00
IGL01601:Atad5 APN 11 79,986,343 (GRCm39) missense probably benign 0.45
IGL01916:Atad5 APN 11 80,003,665 (GRCm39) critical splice donor site probably null
IGL02028:Atad5 APN 11 80,024,936 (GRCm39) missense probably benign 0.20
IGL02095:Atad5 APN 11 79,985,533 (GRCm39) missense probably benign 0.24
IGL02142:Atad5 APN 11 79,985,023 (GRCm39) missense probably benign 0.00
IGL02206:Atad5 APN 11 79,985,009 (GRCm39) missense probably damaging 1.00
IGL02385:Atad5 APN 11 79,985,453 (GRCm39) missense probably benign 0.04
IGL02858:Atad5 APN 11 79,980,601 (GRCm39) missense probably damaging 1.00
IGL02962:Atad5 APN 11 79,999,405 (GRCm39) missense possibly damaging 0.86
PIT4362001:Atad5 UTSW 11 80,002,393 (GRCm39) missense probably benign 0.04
R0040:Atad5 UTSW 11 79,988,840 (GRCm39) missense probably benign
R0157:Atad5 UTSW 11 79,980,643 (GRCm39) missense possibly damaging 0.74
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0211:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.00
R0319:Atad5 UTSW 11 80,011,616 (GRCm39) splice site probably benign
R0401:Atad5 UTSW 11 80,011,525 (GRCm39) missense probably benign 0.11
R0426:Atad5 UTSW 11 80,003,658 (GRCm39) missense probably benign 0.14
R0452:Atad5 UTSW 11 79,997,247 (GRCm39) missense probably damaging 0.98
R0496:Atad5 UTSW 11 79,991,182 (GRCm39) missense probably benign 0.08
R1691:Atad5 UTSW 11 79,986,358 (GRCm39) missense probably benign 0.00
R1812:Atad5 UTSW 11 80,023,873 (GRCm39) missense probably damaging 0.98
R2070:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2071:Atad5 UTSW 11 79,988,878 (GRCm39) splice site probably null
R2153:Atad5 UTSW 11 79,997,203 (GRCm39) missense probably benign 0.04
R2415:Atad5 UTSW 11 79,985,077 (GRCm39) missense probably damaging 1.00
R3917:Atad5 UTSW 11 79,994,120 (GRCm39) missense probably null 0.97
R4025:Atad5 UTSW 11 80,011,512 (GRCm39) missense probably damaging 1.00
R4464:Atad5 UTSW 11 79,991,137 (GRCm39) splice site probably null
R4561:Atad5 UTSW 11 79,986,715 (GRCm39) missense probably benign 0.01
R4579:Atad5 UTSW 11 79,986,017 (GRCm39) missense probably damaging 1.00
R4844:Atad5 UTSW 11 80,005,137 (GRCm39) splice site probably null
R4853:Atad5 UTSW 11 79,986,098 (GRCm39) missense probably damaging 1.00
R4873:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R4875:Atad5 UTSW 11 80,011,515 (GRCm39) missense probably damaging 1.00
R5054:Atad5 UTSW 11 79,985,502 (GRCm39) missense probably benign 0.10
R5226:Atad5 UTSW 11 79,985,888 (GRCm39) missense probably damaging 0.99
R5397:Atad5 UTSW 11 80,002,319 (GRCm39) missense probably damaging 1.00
R5449:Atad5 UTSW 11 80,014,934 (GRCm39) missense probably damaging 1.00
R5571:Atad5 UTSW 11 80,002,382 (GRCm39) missense probably benign 0.05
R5575:Atad5 UTSW 11 79,991,149 (GRCm39) missense probably benign 0.02
R5857:Atad5 UTSW 11 80,022,155 (GRCm39) missense probably benign 0.06
R5927:Atad5 UTSW 11 80,018,111 (GRCm39) missense probably damaging 1.00
R5928:Atad5 UTSW 11 79,985,003 (GRCm39) missense probably damaging 1.00
R5949:Atad5 UTSW 11 79,986,835 (GRCm39) nonsense probably null
R6102:Atad5 UTSW 11 80,002,398 (GRCm39) critical splice donor site probably null
R6254:Atad5 UTSW 11 80,018,215 (GRCm39) missense probably damaging 0.96
R6562:Atad5 UTSW 11 80,024,032 (GRCm39) missense probably benign 0.26
R6744:Atad5 UTSW 11 80,024,858 (GRCm39) missense probably benign 0.00
R7092:Atad5 UTSW 11 80,011,546 (GRCm39) missense possibly damaging 0.68
R7202:Atad5 UTSW 11 79,980,601 (GRCm39) missense probably damaging 1.00
R7345:Atad5 UTSW 11 79,986,832 (GRCm39) missense probably damaging 1.00
R7352:Atad5 UTSW 11 79,994,169 (GRCm39) critical splice donor site probably null
R7358:Atad5 UTSW 11 80,023,862 (GRCm39) missense probably benign 0.32
R7420:Atad5 UTSW 11 79,986,688 (GRCm39) missense probably benign 0.06
R7453:Atad5 UTSW 11 80,009,969 (GRCm39) critical splice donor site probably null
R7990:Atad5 UTSW 11 80,024,079 (GRCm39) nonsense probably null
R8012:Atad5 UTSW 11 79,985,066 (GRCm39) missense probably damaging 1.00
R8152:Atad5 UTSW 11 79,985,996 (GRCm39) missense possibly damaging 0.59
R8421:Atad5 UTSW 11 79,985,384 (GRCm39) missense probably damaging 0.98
R8842:Atad5 UTSW 11 80,000,910 (GRCm39) missense possibly damaging 0.87
R8918:Atad5 UTSW 11 79,986,473 (GRCm39) missense probably benign 0.02
R8943:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R8944:Atad5 UTSW 11 79,986,524 (GRCm39) missense possibly damaging 0.86
R9134:Atad5 UTSW 11 80,023,931 (GRCm39) missense probably benign 0.00
R9137:Atad5 UTSW 11 79,986,481 (GRCm39) missense probably damaging 1.00
R9372:Atad5 UTSW 11 79,985,094 (GRCm39) missense possibly damaging 0.68
R9404:Atad5 UTSW 11 80,005,064 (GRCm39) missense probably damaging 1.00
R9443:Atad5 UTSW 11 80,023,388 (GRCm39) missense probably benign 0.01
R9471:Atad5 UTSW 11 80,023,524 (GRCm39) missense possibly damaging 0.65
R9577:Atad5 UTSW 11 80,004,996 (GRCm39) missense probably damaging 1.00
R9656:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9659:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
R9661:Atad5 UTSW 11 79,980,542 (GRCm39) start gained probably benign
RF003:Atad5 UTSW 11 80,002,386 (GRCm39) missense probably damaging 0.99
X0024:Atad5 UTSW 11 80,023,609 (GRCm39) missense probably benign 0.02
Z1176:Atad5 UTSW 11 79,985,722 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGAGTATGTCTCTACACGC -3'
(R):5'- TGGGTAGACAGACCACTTACC -3'

Sequencing Primer
(F):5'- TCAGGAGATCTCTGAGAAGTTGC -3'
(R):5'- TTACCTAACCTATGAGGGCCAGTC -3'
Posted On 2022-03-25