Incidental Mutation 'R9301:Eml5'
ID 704964
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock # R9301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 98882033 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 133 (C133*)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably null
Transcript: ENSMUST00000065716
AA Change: C133*
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: C133*

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223282
AA Change: C133*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,087,479 N514K probably benign Het
Adssl1 A T 12: 112,636,448 R358W probably damaging Het
Anxa8 T A 14: 34,097,975 I307N probably damaging Het
Atad5 T A 11: 80,096,019 I644N probably damaging Het
Atp5a1 G T 18: 77,781,238 L437F probably damaging Het
Babam1 A G 8: 71,403,040 K259R possibly damaging Het
BC048562 T G 9: 108,445,855 F130V probably damaging Het
Camsap2 T A 1: 136,274,902 probably null Het
Ccne2 A G 4: 11,192,881 I27M probably benign Het
Cd302 A G 2: 60,252,449 V177A possibly damaging Het
Cfap46 T C 7: 139,642,545 K1172R Het
Cic T C 7: 25,291,692 W2141R probably damaging Het
Cpeb3 A G 19: 37,174,073 V301A possibly damaging Het
Cpsf3 A G 12: 21,300,111 K277R possibly damaging Het
Cstl1 A G 2: 148,751,006 H27R possibly damaging Het
Dapk1 T A 13: 60,718,311 I188K possibly damaging Het
Dock6 T C 9: 21,817,815 T1301A probably benign Het
Ermap T A 4: 119,185,547 I260F probably damaging Het
Fbxw22 T G 9: 109,386,585 E198D possibly damaging Het
Flt4 T C 11: 49,625,414 Y115H possibly damaging Het
Fmo9 A C 1: 166,667,225 I369S probably damaging Het
Frmd4a T A 2: 4,153,093 S6T probably benign Het
Gm20075 T A 13: 96,081,113 K73* probably null Het
Golga5 A T 12: 102,476,798 I330L probably benign Het
Helq C A 5: 100,779,292 V643F probably damaging Het
Ino80d A T 1: 63,065,810 L369H probably damaging Het
Kank1 A T 19: 25,411,434 M824L probably benign Het
Lilr4b T C 10: 51,480,705 probably benign Het
Ltbp4 T A 7: 27,322,153 D1003V probably damaging Het
Mapk8ip2 T C 15: 89,457,683 S366P probably damaging Het
Mdga1 T C 17: 29,850,538 H178R probably benign Het
Mlh3 A G 12: 85,245,839 V1266A possibly damaging Het
Nrp1 A G 8: 128,363,378 E78G probably damaging Het
Olfr1080 A G 2: 86,553,474 S217P possibly damaging Het
Olfr1155 A G 2: 87,942,953 V225A probably benign Het
Olfr1427 A T 19: 12,099,462 M59K probably damaging Het
Olfr365 A T 2: 37,201,243 M1L probably benign Het
Ovch2 A G 7: 107,796,608 S68P probably damaging Het
Pappa2 T A 1: 158,845,044 I1110F probably damaging Het
Pcyox1 A C 6: 86,392,259 L195R possibly damaging Het
Pde11a A G 2: 76,017,873 L870P probably damaging Het
Pgpep1 G A 8: 70,650,768 T152M probably damaging Het
Pik3c2a A T 7: 116,346,178 D1464E probably damaging Het
Plcb1 A G 2: 135,325,690 K468R possibly damaging Het
Postn C T 3: 54,385,238 T742I probably benign Het
Ppm1j T A 3: 104,783,741 Y274N probably damaging Het
Ppp2cb T C 8: 33,600,010 C32R possibly damaging Het
Prmt9 T A 8: 77,555,745 Y90* probably null Het
Ptk2 T C 15: 73,274,497 Y441C probably damaging Het
Rabggta T A 14: 55,719,626 I266L probably benign Het
Rft1 C T 14: 30,676,855 R261W probably damaging Het
Rsrc1 C T 3: 67,290,347 A195V probably damaging Het
Rtkn2 T G 10: 68,035,847 L355R possibly damaging Het
Runx1t1 A T 4: 13,875,477 D427V possibly damaging Het
Slc15a4 T G 5: 127,596,748 H534P probably benign Het
Slc16a7 T C 10: 125,231,011 N253S probably damaging Het
Slc29a1 A G 17: 45,586,137 S408P probably damaging Het
Slc52a2 G A 15: 76,540,206 A215T probably damaging Het
Smc1b T A 15: 85,127,794 I126L probably damaging Het
Sycp2 A T 2: 178,381,857 N455K probably benign Het
Tbck T C 3: 132,837,977 V863A probably benign Het
Tfap2c A G 2: 172,553,427 M263V probably benign Het
Tmem45a A G 16: 56,806,771 V245A probably damaging Het
Top2a C T 11: 99,006,964 G759D probably damaging Het
Traf5 A G 1: 191,997,528 S218P Het
Tsfm T C 10: 127,030,633 R20G probably benign Het
Ugt2a2 G T 5: 87,460,523 Q486K probably damaging Het
Usp34 T A 11: 23,472,951 D3108E Het
Wnt11 A G 7: 98,846,589 Y100C probably damaging Het
Zbtb49 A G 5: 38,213,587 C317R probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9368:Eml5 UTSW 12 98796578 missense probably benign 0.31
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGGCCACAATCTAAGATTTTATG -3'
(R):5'- TGCAATGAATACATCTGTCTGCC -3'

Sequencing Primer
(F):5'- CCGTCTAAAGTTTACAAACCAATGG -3'
(R):5'- GAATACATCTGTCTGCCTTAAAGG -3'
Posted On 2022-03-25