Incidental Mutation 'R9301:Dapk1'
ID 704967
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Name death associated protein kinase 1
Synonyms DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9301 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 60749761-60911005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 60866125 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 188 (I188K)
Ref Sequence ENSEMBL: ENSMUSP00000076666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
AlphaFold Q80YE7
Predicted Effect possibly damaging
Transcript: ENSMUST00000044083
AA Change: I188K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: I188K

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077453
AA Change: I188K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: I188K

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224789
Predicted Effect possibly damaging
Transcript: ENSMUST00000226059
AA Change: I188K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,881,128 (GRCm39) N514K probably benign Het
Adss1 A T 12: 112,602,882 (GRCm39) R358W probably damaging Het
Anxa8 T A 14: 33,819,932 (GRCm39) I307N probably damaging Het
Atad5 T A 11: 79,986,845 (GRCm39) I644N probably damaging Het
Atp5f1a G T 18: 77,868,938 (GRCm39) L437F probably damaging Het
Babam1 A G 8: 71,855,684 (GRCm39) K259R possibly damaging Het
BC048562 T G 9: 108,323,054 (GRCm39) F130V probably damaging Het
Btf3l4b T A 13: 96,217,621 (GRCm39) K73* probably null Het
Camsap2 T A 1: 136,202,640 (GRCm39) probably null Het
Ccne2 A G 4: 11,192,881 (GRCm39) I27M probably benign Het
Cd302 A G 2: 60,082,793 (GRCm39) V177A possibly damaging Het
Cfap46 T C 7: 139,222,461 (GRCm39) K1172R Het
Cic T C 7: 24,991,117 (GRCm39) W2141R probably damaging Het
Cpeb3 A G 19: 37,151,473 (GRCm39) V301A possibly damaging Het
Cpsf3 A G 12: 21,350,112 (GRCm39) K277R possibly damaging Het
Cstl1 A G 2: 148,592,926 (GRCm39) H27R possibly damaging Het
Dock6 T C 9: 21,729,111 (GRCm39) T1301A probably benign Het
Eml5 A T 12: 98,848,292 (GRCm39) C133* probably null Het
Ermap T A 4: 119,042,744 (GRCm39) I260F probably damaging Het
Fbxw22 T G 9: 109,215,653 (GRCm39) E198D possibly damaging Het
Flt4 T C 11: 49,516,241 (GRCm39) Y115H possibly damaging Het
Fmo9 A C 1: 166,494,794 (GRCm39) I369S probably damaging Het
Frmd4a T A 2: 4,157,904 (GRCm39) S6T probably benign Het
Golga5 A T 12: 102,443,057 (GRCm39) I330L probably benign Het
Helq C A 5: 100,927,158 (GRCm39) V643F probably damaging Het
Ino80d A T 1: 63,104,969 (GRCm39) L369H probably damaging Het
Kank1 A T 19: 25,388,798 (GRCm39) M824L probably benign Het
Lilrb4b T C 10: 51,356,801 (GRCm39) probably benign Het
Ltbp4 T A 7: 27,021,578 (GRCm39) D1003V probably damaging Het
Mapk8ip2 T C 15: 89,341,886 (GRCm39) S366P probably damaging Het
Mdga1 T C 17: 30,069,512 (GRCm39) H178R probably benign Het
Mlh3 A G 12: 85,292,613 (GRCm39) V1266A possibly damaging Het
Nrp1 A G 8: 129,089,859 (GRCm39) E78G probably damaging Het
Or1l4 A T 2: 37,091,255 (GRCm39) M1L probably benign Het
Or4z4 A T 19: 12,076,826 (GRCm39) M59K probably damaging Het
Or5d16 A G 2: 87,773,297 (GRCm39) V225A probably benign Het
Or8k33 A G 2: 86,383,818 (GRCm39) S217P possibly damaging Het
Ovch2 A G 7: 107,395,815 (GRCm39) S68P probably damaging Het
Pappa2 T A 1: 158,672,614 (GRCm39) I1110F probably damaging Het
Pcyox1 A C 6: 86,369,241 (GRCm39) L195R possibly damaging Het
Pde11a A G 2: 75,848,217 (GRCm39) L870P probably damaging Het
Pgpep1 G A 8: 71,103,418 (GRCm39) T152M probably damaging Het
Pik3c2a A T 7: 115,945,413 (GRCm39) D1464E probably damaging Het
Plcb1 A G 2: 135,167,610 (GRCm39) K468R possibly damaging Het
Postn C T 3: 54,292,659 (GRCm39) T742I probably benign Het
Ppm1j T A 3: 104,691,057 (GRCm39) Y274N probably damaging Het
Ppp2cb T C 8: 34,090,038 (GRCm39) C32R possibly damaging Het
Prmt9 T A 8: 78,282,374 (GRCm39) Y90* probably null Het
Ptk2 T C 15: 73,146,346 (GRCm39) Y441C probably damaging Het
Rabggta T A 14: 55,957,083 (GRCm39) I266L probably benign Het
Rft1 C T 14: 30,398,812 (GRCm39) R261W probably damaging Het
Rsrc1 C T 3: 67,197,680 (GRCm39) A195V probably damaging Het
Rtkn2 T G 10: 67,871,677 (GRCm39) L355R possibly damaging Het
Runx1t1 A T 4: 13,875,477 (GRCm39) D427V possibly damaging Het
Slc15a4 T G 5: 127,673,812 (GRCm39) H534P probably benign Het
Slc16a7 T C 10: 125,066,880 (GRCm39) N253S probably damaging Het
Slc29a1 A G 17: 45,897,063 (GRCm39) S408P probably damaging Het
Slc52a2 G A 15: 76,424,406 (GRCm39) A215T probably damaging Het
Smc1b T A 15: 85,011,995 (GRCm39) I126L probably damaging Het
Sycp2 A T 2: 178,023,650 (GRCm39) N455K probably benign Het
Tbck T C 3: 132,543,738 (GRCm39) V863A probably benign Het
Tfap2c A G 2: 172,395,347 (GRCm39) M263V probably benign Het
Tmem45a A G 16: 56,627,134 (GRCm39) V245A probably damaging Het
Top2a C T 11: 98,897,790 (GRCm39) G759D probably damaging Het
Traf5 A G 1: 191,729,489 (GRCm39) S218P Het
Tsfm T C 10: 126,866,502 (GRCm39) R20G probably benign Het
Ugt2a2 G T 5: 87,608,382 (GRCm39) Q486K probably damaging Het
Usp34 T A 11: 23,422,951 (GRCm39) D3108E Het
Wnt11 A G 7: 98,495,796 (GRCm39) Y100C probably damaging Het
Zbtb49 A G 5: 38,370,931 (GRCm39) C317R probably benign Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60,908,854 (GRCm39) missense probably benign 0.23
IGL00500:Dapk1 APN 13 60,908,618 (GRCm39) missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60,909,062 (GRCm39) missense probably benign 0.00
IGL00903:Dapk1 APN 13 60,909,211 (GRCm39) missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60,908,612 (GRCm39) missense probably benign
IGL01535:Dapk1 APN 13 60,878,845 (GRCm39) splice site probably benign
IGL01755:Dapk1 APN 13 60,908,990 (GRCm39) missense possibly damaging 0.63
IGL01755:Dapk1 APN 13 60,908,989 (GRCm39) missense probably damaging 0.97
IGL01862:Dapk1 APN 13 60,874,424 (GRCm39) missense probably benign 0.39
IGL01985:Dapk1 APN 13 60,884,074 (GRCm39) missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60,878,696 (GRCm39) missense probably benign
IGL02376:Dapk1 APN 13 60,844,208 (GRCm39) missense probably benign 0.00
IGL02449:Dapk1 APN 13 60,867,584 (GRCm39) splice site probably benign
IGL02490:Dapk1 APN 13 60,897,148 (GRCm39) missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60,909,621 (GRCm39) nonsense probably null
IGL02516:Dapk1 APN 13 60,844,161 (GRCm39) missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60,899,031 (GRCm39) missense probably benign
IGL02604:Dapk1 APN 13 60,896,134 (GRCm39) missense probably benign
IGL03035:Dapk1 APN 13 60,864,587 (GRCm39) missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60,909,126 (GRCm39) missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60,865,963 (GRCm39) splice site probably benign
R0116:Dapk1 UTSW 13 60,908,914 (GRCm39) missense probably benign
R0165:Dapk1 UTSW 13 60,909,407 (GRCm39) missense probably benign 0.39
R0357:Dapk1 UTSW 13 60,877,372 (GRCm39) nonsense probably null
R0446:Dapk1 UTSW 13 60,873,101 (GRCm39) splice site probably null
R0502:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0503:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0597:Dapk1 UTSW 13 60,909,198 (GRCm39) missense probably benign 0.40
R0614:Dapk1 UTSW 13 60,865,946 (GRCm39) missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60,905,262 (GRCm39) missense probably benign 0.14
R1023:Dapk1 UTSW 13 60,878,799 (GRCm39) missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60,869,679 (GRCm39) critical splice donor site probably null
R1101:Dapk1 UTSW 13 60,864,599 (GRCm39) missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60,901,957 (GRCm39) missense probably benign 0.28
R1630:Dapk1 UTSW 13 60,877,345 (GRCm39) missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60,866,278 (GRCm39) critical splice donor site probably null
R1799:Dapk1 UTSW 13 60,867,468 (GRCm39) missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60,869,671 (GRCm39) missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60,899,022 (GRCm39) missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60,909,481 (GRCm39) missense possibly damaging 0.80
R2131:Dapk1 UTSW 13 60,877,345 (GRCm39) missense possibly damaging 0.91
R2154:Dapk1 UTSW 13 60,877,317 (GRCm39) missense probably benign 0.36
R2288:Dapk1 UTSW 13 60,909,563 (GRCm39) missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60,905,167 (GRCm39) missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60,878,745 (GRCm39) missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60,900,030 (GRCm39) missense probably benign 0.34
R2909:Dapk1 UTSW 13 60,864,631 (GRCm39) critical splice donor site probably null
R2926:Dapk1 UTSW 13 60,867,564 (GRCm39) missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60,896,014 (GRCm39) missense probably benign 0.09
R3810:Dapk1 UTSW 13 60,908,503 (GRCm39) missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4375:Dapk1 UTSW 13 60,909,403 (GRCm39) missense probably benign
R4377:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4490:Dapk1 UTSW 13 60,865,942 (GRCm39) missense probably benign 0.26
R4576:Dapk1 UTSW 13 60,869,636 (GRCm39) missense probably benign 0.13
R4599:Dapk1 UTSW 13 60,865,861 (GRCm39) missense probably benign 0.22
R4682:Dapk1 UTSW 13 60,898,961 (GRCm39) missense probably benign 0.41
R4717:Dapk1 UTSW 13 60,874,476 (GRCm39) critical splice donor site probably null
R4775:Dapk1 UTSW 13 60,897,156 (GRCm39) missense probably benign 0.02
R4790:Dapk1 UTSW 13 60,870,919 (GRCm39) frame shift probably null
R4897:Dapk1 UTSW 13 60,909,600 (GRCm39) missense probably benign 0.01
R4931:Dapk1 UTSW 13 60,908,774 (GRCm39) missense probably benign 0.04
R5113:Dapk1 UTSW 13 60,869,592 (GRCm39) missense probably benign 0.01
R5503:Dapk1 UTSW 13 60,873,126 (GRCm39) missense probably benign 0.15
R5948:Dapk1 UTSW 13 60,877,209 (GRCm39) missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60,909,476 (GRCm39) missense probably benign 0.00
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60,909,580 (GRCm39) missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60,909,140 (GRCm39) missense probably benign 0.01
R6331:Dapk1 UTSW 13 60,877,256 (GRCm39) nonsense probably null
R6553:Dapk1 UTSW 13 60,908,975 (GRCm39) missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60,909,161 (GRCm39) missense probably benign 0.03
R6602:Dapk1 UTSW 13 60,897,018 (GRCm39) missense probably benign 0.20
R6640:Dapk1 UTSW 13 60,864,628 (GRCm39) missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60,908,708 (GRCm39) missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60,873,154 (GRCm39) missense probably benign 0.22
R6799:Dapk1 UTSW 13 60,900,049 (GRCm39) missense probably benign
R6809:Dapk1 UTSW 13 60,899,103 (GRCm39) missense probably benign 0.00
R6915:Dapk1 UTSW 13 60,844,256 (GRCm39) missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60,884,138 (GRCm39) missense probably benign 0.11
R6979:Dapk1 UTSW 13 60,896,095 (GRCm39) missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60,844,209 (GRCm39) missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60,909,599 (GRCm39) missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60,902,024 (GRCm39) missense probably benign 0.02
R7203:Dapk1 UTSW 13 60,844,149 (GRCm39) missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60,867,455 (GRCm39) missense probably benign 0.00
R7448:Dapk1 UTSW 13 60,898,990 (GRCm39) missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60,905,311 (GRCm39) missense probably benign 0.18
R7532:Dapk1 UTSW 13 60,878,700 (GRCm39) missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60,908,987 (GRCm39) missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60,909,365 (GRCm39) missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60,899,007 (GRCm39) missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60,873,153 (GRCm39) missense probably benign 0.41
R7822:Dapk1 UTSW 13 60,873,715 (GRCm39) missense probably benign 0.05
R7973:Dapk1 UTSW 13 60,909,377 (GRCm39) missense probably damaging 1.00
R8103:Dapk1 UTSW 13 60,897,009 (GRCm39) missense probably damaging 0.98
R8121:Dapk1 UTSW 13 60,909,212 (GRCm39) missense probably damaging 0.99
R8245:Dapk1 UTSW 13 60,878,710 (GRCm39) missense probably benign
R8401:Dapk1 UTSW 13 60,870,904 (GRCm39) missense probably benign 0.01
R8419:Dapk1 UTSW 13 60,887,911 (GRCm39) missense probably benign 0.00
R8926:Dapk1 UTSW 13 60,908,734 (GRCm39) missense probably damaging 0.98
R9063:Dapk1 UTSW 13 60,866,264 (GRCm39) missense probably benign 0.06
R9131:Dapk1 UTSW 13 60,909,208 (GRCm39) missense probably damaging 1.00
R9176:Dapk1 UTSW 13 60,866,262 (GRCm39) missense probably damaging 1.00
R9407:Dapk1 UTSW 13 60,898,991 (GRCm39) nonsense probably null
R9491:Dapk1 UTSW 13 60,877,369 (GRCm39) missense probably benign 0.44
R9510:Dapk1 UTSW 13 60,910,203 (GRCm39) missense unknown
R9624:Dapk1 UTSW 13 60,895,937 (GRCm39) missense probably benign 0.31
R9726:Dapk1 UTSW 13 60,898,948 (GRCm39) missense probably benign 0.25
R9794:Dapk1 UTSW 13 60,909,082 (GRCm39) missense probably damaging 0.98
Z1176:Dapk1 UTSW 13 60,908,618 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGGGTAAATCTCCTCTGCC -3'
(R):5'- AAGGAGCCAACATGATCTATCTGG -3'

Sequencing Primer
(F):5'- GGTAAATCTCCTCTGCCCTTGGG -3'
(R):5'- AGCCAACATGATCTATCTGGTCAGTC -3'
Posted On 2022-03-25