Incidental Mutation 'R0737:Lrp2'
ID 70498
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Name low density lipoprotein receptor-related protein 2
Synonyms D230004K18Rik, b2b1625.2Clo, Megalin, Gp330
MMRRC Submission 038918-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0737 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69254679-69416373 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 69278513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 3947 (Y3947H)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000080953
AA Change: Y3947H

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: Y3947H

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 69,437,813 (GRCm39) probably benign Het
Aff4 T A 11: 53,301,780 (GRCm39) L1043* probably null Het
Ankrd11 G T 8: 123,622,575 (GRCm39) R426S probably damaging Het
Atm T A 9: 53,367,866 (GRCm39) N2422I probably damaging Het
Bahcc1 C A 11: 120,163,667 (GRCm39) P655Q probably damaging Het
Baz2a A G 10: 127,951,949 (GRCm39) I556V possibly damaging Het
Ccdc33 T C 9: 57,989,331 (GRCm39) D114G probably damaging Het
Cdk5rap2 T C 4: 70,255,612 (GRCm39) H424R probably benign Het
Cfap57 T C 4: 118,438,299 (GRCm39) E864G possibly damaging Het
Cit T A 5: 116,084,978 (GRCm39) S836R probably damaging Het
Clip4 C T 17: 72,144,694 (GRCm39) Q95* probably null Het
Col17a1 C T 19: 47,657,872 (GRCm39) G433S possibly damaging Het
Col6a3 A G 1: 90,756,020 (GRCm39) F90L probably damaging Het
Cybc1 C T 11: 121,118,068 (GRCm39) probably null Het
Degs1l G A 1: 180,882,944 (GRCm39) M235I probably benign Het
Dnah9 T C 11: 65,998,724 (GRCm39) H1108R probably damaging Het
Elac1 A T 18: 73,872,110 (GRCm39) M295K probably damaging Het
Epas1 G T 17: 87,136,884 (GRCm39) G816C possibly damaging Het
Ermap C A 4: 119,035,707 (GRCm39) C427F probably damaging Het
Fbxo44 T C 4: 148,243,266 (GRCm39) probably benign Het
Fmo4 T A 1: 162,635,961 (GRCm39) K14* probably null Het
Gadl1 G A 9: 115,903,055 (GRCm39) M461I probably damaging Het
Garnl3 T A 2: 32,880,654 (GRCm39) I868F probably damaging Het
Gm7168 A G 17: 14,169,245 (GRCm39) D204G probably damaging Het
Hs6st3 T C 14: 120,106,795 (GRCm39) F401S possibly damaging Het
Kcnmb1 A T 11: 33,914,701 (GRCm39) M1L probably benign Het
Krt35 T C 11: 99,984,620 (GRCm39) T292A probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lamb2 T A 9: 108,360,993 (GRCm39) W572R probably benign Het
Letmd1 A G 15: 100,367,702 (GRCm39) T87A probably damaging Het
Mocos T C 18: 24,822,044 (GRCm39) F685L probably damaging Het
Nsun6 A T 2: 15,001,285 (GRCm39) F424I probably damaging Het
Nup88 A G 11: 70,860,776 (GRCm39) M1T probably null Het
Or13p5 C T 4: 118,592,421 (GRCm39) R232C probably benign Het
Or14c45 C T 7: 86,176,195 (GRCm39) P77S probably damaging Het
Or4c29 T C 2: 88,740,617 (GRCm39) N40S probably damaging Het
Pcdhb12 T A 18: 37,570,762 (GRCm39) V636D probably damaging Het
Pclo C A 5: 14,565,453 (GRCm39) A73E probably damaging Het
Pdlim7 A T 13: 55,652,693 (GRCm39) probably null Het
Phldb1 G A 9: 44,610,933 (GRCm39) P67S possibly damaging Het
Ppp2r2b T C 18: 43,192,257 (GRCm39) T17A probably benign Het
Ppp4r3c2 A G X: 88,797,926 (GRCm39) H586R probably benign Het
Rab11fip4 T C 11: 79,574,328 (GRCm39) V241A probably benign Het
Slc41a1 T C 1: 131,768,690 (GRCm39) L216P probably damaging Het
Slco1a8 G T 6: 141,949,154 (GRCm39) A74E possibly damaging Het
Smg6 T A 11: 75,050,662 (GRCm39) D1352E probably damaging Het
Tbc1d9 A T 8: 83,985,942 (GRCm39) I816F probably damaging Het
Tex264 T C 9: 106,536,498 (GRCm39) T220A probably benign Het
Tmco6 G A 18: 36,874,829 (GRCm39) V439I probably damaging Het
Tmem64 A G 4: 15,266,717 (GRCm39) I256V probably damaging Het
Tnks1bp1 A G 2: 84,882,880 (GRCm39) S236G possibly damaging Het
Tsc1 A G 2: 28,560,942 (GRCm39) T267A possibly damaging Het
Txndc2 A G 17: 65,946,548 (GRCm39) probably null Het
Vmn2r94 G A 17: 18,497,695 (GRCm39) Q26* probably null Het
Zan T C 5: 137,387,511 (GRCm39) D4900G unknown Het
Zkscan3 T C 13: 21,572,766 (GRCm39) T122A probably benign Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69,338,123 (GRCm39) missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69,316,624 (GRCm39) missense probably benign 0.00
IGL00782:Lrp2 APN 2 69,331,989 (GRCm39) missense probably benign 0.14
IGL00821:Lrp2 APN 2 69,289,860 (GRCm39) missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69,352,225 (GRCm39) missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69,299,780 (GRCm39) missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69,354,417 (GRCm39) missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69,322,776 (GRCm39) nonsense probably null
IGL01131:Lrp2 APN 2 69,329,583 (GRCm39) missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69,341,328 (GRCm39) missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69,333,870 (GRCm39) missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69,382,814 (GRCm39) splice site probably benign
IGL01375:Lrp2 APN 2 69,308,910 (GRCm39) splice site probably benign
IGL01384:Lrp2 APN 2 69,313,846 (GRCm39) missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69,284,156 (GRCm39) missense probably null 1.00
IGL01411:Lrp2 APN 2 69,312,611 (GRCm39) missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69,355,630 (GRCm39) missense probably benign
IGL01444:Lrp2 APN 2 69,274,060 (GRCm39) missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69,302,783 (GRCm39) missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69,322,804 (GRCm39) missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69,259,050 (GRCm39) missense probably benign
IGL01761:Lrp2 APN 2 69,311,579 (GRCm39) missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69,316,528 (GRCm39) missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69,313,945 (GRCm39) missense probably benign 0.08
IGL02015:Lrp2 APN 2 69,357,922 (GRCm39) missense probably benign 0.00
IGL02104:Lrp2 APN 2 69,340,762 (GRCm39) missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69,367,960 (GRCm39) missense probably benign 0.01
IGL02134:Lrp2 APN 2 69,343,723 (GRCm39) critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69,297,224 (GRCm39) missense probably benign 0.01
IGL02212:Lrp2 APN 2 69,281,608 (GRCm39) missense probably benign 0.00
IGL02240:Lrp2 APN 2 69,365,390 (GRCm39) missense probably benign
IGL02248:Lrp2 APN 2 69,313,152 (GRCm39) missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69,294,980 (GRCm39) missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69,299,977 (GRCm39) missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69,291,649 (GRCm39) missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69,352,117 (GRCm39) missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69,295,145 (GRCm39) splice site probably benign
IGL02508:Lrp2 APN 2 69,333,774 (GRCm39) missense probably benign 0.04
IGL02751:Lrp2 APN 2 69,363,806 (GRCm39) missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69,337,080 (GRCm39) missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69,382,794 (GRCm39) missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69,285,854 (GRCm39) missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69,318,181 (GRCm39) missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69,285,797 (GRCm39) splice site probably benign
IGL02990:Lrp2 APN 2 69,271,740 (GRCm39) missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69,367,897 (GRCm39) missense probably benign 0.43
IGL03038:Lrp2 APN 2 69,305,808 (GRCm39) missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69,313,477 (GRCm39) missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69,285,177 (GRCm39) missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69,307,370 (GRCm39) missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69,379,386 (GRCm39) missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69,285,796 (GRCm39) splice site probably benign
IGL03163:Lrp2 APN 2 69,331,870 (GRCm39) nonsense probably null
IGL03164:Lrp2 APN 2 69,295,043 (GRCm39) missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69,353,538 (GRCm39) missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69,296,609 (GRCm39) missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69,268,822 (GRCm39) splice site probably benign
IGL03288:Lrp2 APN 2 69,256,383 (GRCm39) missense probably benign 0.02
IGL03350:Lrp2 APN 2 69,268,797 (GRCm39) missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69,261,496 (GRCm39) missense probably damaging 1.00
casual UTSW 2 69,329,607 (GRCm39) missense probably benign
nonchalant UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
Presto UTSW 2 69,289,875 (GRCm39) nonsense probably null
relaxed UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
unguarded UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
Unintended UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
BB009:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
BB019:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
IGL02835:Lrp2 UTSW 2 69,335,648 (GRCm39) missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69,288,792 (GRCm39) missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69,367,882 (GRCm39) missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69,305,747 (GRCm39) missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0008:Lrp2 UTSW 2 69,346,895 (GRCm39) missense probably benign 0.42
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably benign 0.01
R0044:Lrp2 UTSW 2 69,357,899 (GRCm39) missense probably damaging 0.96
R0048:Lrp2 UTSW 2 69,295,971 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69,305,756 (GRCm39) missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69,307,384 (GRCm39) missense probably benign
R0167:Lrp2 UTSW 2 69,256,002 (GRCm39) missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69,367,907 (GRCm39) missense probably null 1.00
R0243:Lrp2 UTSW 2 69,258,974 (GRCm39) missense probably benign 0.00
R0308:Lrp2 UTSW 2 69,313,326 (GRCm39) splice site probably benign
R0323:Lrp2 UTSW 2 69,299,983 (GRCm39) missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69,365,387 (GRCm39) missense probably benign 0.10
R0374:Lrp2 UTSW 2 69,260,651 (GRCm39) missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69,290,681 (GRCm39) splice site probably benign
R0391:Lrp2 UTSW 2 69,287,202 (GRCm39) missense probably damaging 0.99
R0395:Lrp2 UTSW 2 69,263,421 (GRCm39) missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69,309,492 (GRCm39) missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69,355,578 (GRCm39) missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69,338,145 (GRCm39) missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69,341,361 (GRCm39) missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69,258,998 (GRCm39) missense probably benign 0.00
R0544:Lrp2 UTSW 2 69,322,275 (GRCm39) missense probably benign 0.18
R0548:Lrp2 UTSW 2 69,367,982 (GRCm39) splice site probably benign
R0593:Lrp2 UTSW 2 69,297,350 (GRCm39) missense probably benign
R0608:Lrp2 UTSW 2 69,316,587 (GRCm39) missense probably benign 0.02
R0633:Lrp2 UTSW 2 69,278,464 (GRCm39) missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69,281,724 (GRCm39) missense probably benign 0.19
R0718:Lrp2 UTSW 2 69,341,292 (GRCm39) missense probably damaging 1.00
R0771:Lrp2 UTSW 2 69,338,334 (GRCm39) missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69,348,709 (GRCm39) missense probably benign 0.32
R0885:Lrp2 UTSW 2 69,312,697 (GRCm39) missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69,318,182 (GRCm39) missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69,354,380 (GRCm39) missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69,353,646 (GRCm39) splice site probably null
R1301:Lrp2 UTSW 2 69,258,948 (GRCm39) missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69,287,262 (GRCm39) missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69,313,738 (GRCm39) missense probably damaging 0.99
R1459:Lrp2 UTSW 2 69,290,821 (GRCm39) missense probably damaging 1.00
R1529:Lrp2 UTSW 2 69,353,526 (GRCm39) missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69,331,074 (GRCm39) missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69,332,954 (GRCm39) missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69,333,005 (GRCm39) missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69,297,107 (GRCm39) critical splice donor site probably null
R1689:Lrp2 UTSW 2 69,333,873 (GRCm39) missense probably benign 0.09
R1693:Lrp2 UTSW 2 69,340,762 (GRCm39) missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69,326,833 (GRCm39) missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69,333,874 (GRCm39) missense probably benign 0.04
R1834:Lrp2 UTSW 2 69,297,224 (GRCm39) missense probably benign 0.01
R1921:Lrp2 UTSW 2 69,353,631 (GRCm39) missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69,297,434 (GRCm39) missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69,338,187 (GRCm39) missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2093:Lrp2 UTSW 2 69,366,365 (GRCm39) missense probably benign 0.25
R2108:Lrp2 UTSW 2 69,336,968 (GRCm39) missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69,313,729 (GRCm39) missense probably benign 0.05
R2122:Lrp2 UTSW 2 69,314,051 (GRCm39) missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69,341,411 (GRCm39) missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69,297,372 (GRCm39) missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69,341,354 (GRCm39) missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69,322,191 (GRCm39) missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69,336,718 (GRCm39) splice site probably null
R2984:Lrp2 UTSW 2 69,256,158 (GRCm39) splice site probably null
R3085:Lrp2 UTSW 2 69,297,479 (GRCm39) missense probably benign 0.05
R3103:Lrp2 UTSW 2 69,262,328 (GRCm39) missense probably benign 0.00
R3727:Lrp2 UTSW 2 69,340,773 (GRCm39) missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3731:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69,365,251 (GRCm39) critical splice donor site probably null
R3764:Lrp2 UTSW 2 69,326,680 (GRCm39) missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69,335,449 (GRCm39) missense probably benign 0.34
R3778:Lrp2 UTSW 2 69,339,548 (GRCm39) missense probably benign 0.00
R3808:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69,331,892 (GRCm39) missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69,294,923 (GRCm39) missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69,256,356 (GRCm39) missense probably benign 0.03
R3852:Lrp2 UTSW 2 69,367,909 (GRCm39) missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69,289,816 (GRCm39) critical splice donor site probably null
R3877:Lrp2 UTSW 2 69,379,391 (GRCm39) missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69,336,720 (GRCm39) missense probably benign
R4081:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69,343,617 (GRCm39) missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69,260,606 (GRCm39) critical splice donor site probably null
R4193:Lrp2 UTSW 2 69,297,487 (GRCm39) missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69,310,438 (GRCm39) missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69,256,335 (GRCm39) nonsense probably null
R4352:Lrp2 UTSW 2 69,262,526 (GRCm39) critical splice donor site probably null
R4407:Lrp2 UTSW 2 69,332,861 (GRCm39) missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69,297,513 (GRCm39) missense probably benign 0.09
R4416:Lrp2 UTSW 2 69,357,575 (GRCm39) missense probably benign 0.18
R4426:Lrp2 UTSW 2 69,336,692 (GRCm39) missense probably benign 0.00
R4510:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69,310,406 (GRCm39) missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69,343,629 (GRCm39) missense probably benign 0.13
R4591:Lrp2 UTSW 2 69,366,419 (GRCm39) missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69,288,771 (GRCm39) nonsense probably null
R4622:Lrp2 UTSW 2 69,290,693 (GRCm39) missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69,319,473 (GRCm39) splice site probably null
R4633:Lrp2 UTSW 2 69,291,761 (GRCm39) missense probably benign 0.16
R4636:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69,297,337 (GRCm39) missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69,319,642 (GRCm39) missense probably benign 0.02
R4712:Lrp2 UTSW 2 69,336,895 (GRCm39) missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69,318,310 (GRCm39) missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69,311,517 (GRCm39) missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4733:Lrp2 UTSW 2 69,363,899 (GRCm39) missense probably benign
R4777:Lrp2 UTSW 2 69,312,608 (GRCm39) missense probably damaging 1.00
R4779:Lrp2 UTSW 2 69,290,059 (GRCm39) missense possibly damaging 0.75
R4786:Lrp2 UTSW 2 69,368,300 (GRCm39) missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69,299,755 (GRCm39) missense probably benign 0.06
R4845:Lrp2 UTSW 2 69,339,585 (GRCm39) missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69,309,457 (GRCm39) missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69,302,712 (GRCm39) missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69,366,332 (GRCm39) missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69,311,732 (GRCm39) missense probably benign 0.01
R5075:Lrp2 UTSW 2 69,296,102 (GRCm39) missense probably benign 0.00
R5078:Lrp2 UTSW 2 69,331,874 (GRCm39) missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69,319,502 (GRCm39) missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69,331,834 (GRCm39) missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69,260,686 (GRCm39) missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69,382,693 (GRCm39) splice site probably null
R5223:Lrp2 UTSW 2 69,354,397 (GRCm39) missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69,287,163 (GRCm39) splice site probably null
R5267:Lrp2 UTSW 2 69,379,322 (GRCm39) missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69,343,698 (GRCm39) missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69,355,572 (GRCm39) missense probably benign 0.01
R5355:Lrp2 UTSW 2 69,285,182 (GRCm39) nonsense probably null
R5356:Lrp2 UTSW 2 69,295,052 (GRCm39) missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69,289,904 (GRCm39) missense probably benign 0.04
R5486:Lrp2 UTSW 2 69,267,809 (GRCm39) missense probably benign 0.04
R5554:Lrp2 UTSW 2 69,382,768 (GRCm39) missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69,281,632 (GRCm39) missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69,294,968 (GRCm39) missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69,329,607 (GRCm39) missense probably benign
R5605:Lrp2 UTSW 2 69,353,643 (GRCm39) missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69,302,762 (GRCm39) missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69,350,258 (GRCm39) missense probably null 0.80
R5686:Lrp2 UTSW 2 69,341,405 (GRCm39) missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69,332,897 (GRCm39) missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69,281,726 (GRCm39) missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69,339,491 (GRCm39) missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69,297,221 (GRCm39) missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69,285,869 (GRCm39) missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69,310,497 (GRCm39) missense probably benign 0.00
R5892:Lrp2 UTSW 2 69,273,120 (GRCm39) missense probably benign
R5951:Lrp2 UTSW 2 69,326,667 (GRCm39) splice site probably null
R5974:Lrp2 UTSW 2 69,289,892 (GRCm39) missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69,365,349 (GRCm39) missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69,337,098 (GRCm39) missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69,313,901 (GRCm39) missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69,341,345 (GRCm39) missense probably benign 0.00
R6177:Lrp2 UTSW 2 69,340,763 (GRCm39) frame shift probably null
R6180:Lrp2 UTSW 2 69,333,868 (GRCm39) missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69,299,822 (GRCm39) missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69,312,710 (GRCm39) missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69,296,684 (GRCm39) missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69,267,025 (GRCm39) missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69,268,811 (GRCm39) missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69,313,787 (GRCm39) missense probably benign 0.02
R6385:Lrp2 UTSW 2 69,326,128 (GRCm39) missense probably benign 0.22
R6429:Lrp2 UTSW 2 69,291,631 (GRCm39) missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69,335,500 (GRCm39) missense probably benign 0.00
R6524:Lrp2 UTSW 2 69,266,983 (GRCm39) missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69,339,647 (GRCm39) missense probably benign 0.00
R6594:Lrp2 UTSW 2 69,270,267 (GRCm39) missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69,299,749 (GRCm39) missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69,284,202 (GRCm39) missense probably benign 0.01
R6718:Lrp2 UTSW 2 69,314,124 (GRCm39) missense probably benign 0.09
R6736:Lrp2 UTSW 2 69,278,555 (GRCm39) missense probably benign 0.02
R6738:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69,314,248 (GRCm39) missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69,348,787 (GRCm39) missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69,343,612 (GRCm39) missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69,343,721 (GRCm39) missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69,354,485 (GRCm39) missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69,340,846 (GRCm39) missense probably benign
R6902:Lrp2 UTSW 2 69,289,847 (GRCm39) missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69,302,709 (GRCm39) missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69,319,649 (GRCm39) missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69,302,799 (GRCm39) missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69,313,552 (GRCm39) missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69,313,372 (GRCm39) missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69,352,131 (GRCm39) missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69,296,089 (GRCm39) missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69,285,152 (GRCm39) critical splice donor site probably null
R7150:Lrp2 UTSW 2 69,318,395 (GRCm39) missense probably damaging 0.99
R7165:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R7174:Lrp2 UTSW 2 69,263,416 (GRCm39) missense probably benign 0.11
R7204:Lrp2 UTSW 2 69,302,877 (GRCm39) missense probably benign 0.25
R7275:Lrp2 UTSW 2 69,289,875 (GRCm39) nonsense probably null
R7278:Lrp2 UTSW 2 69,316,696 (GRCm39) missense probably damaging 1.00
R7296:Lrp2 UTSW 2 69,312,725 (GRCm39) missense probably benign 0.04
R7315:Lrp2 UTSW 2 69,322,166 (GRCm39) missense probably damaging 0.98
R7342:Lrp2 UTSW 2 69,309,634 (GRCm39) missense possibly damaging 0.95
R7351:Lrp2 UTSW 2 69,278,486 (GRCm39) missense probably damaging 1.00
R7352:Lrp2 UTSW 2 69,302,741 (GRCm39) missense probably benign 0.04
R7366:Lrp2 UTSW 2 69,314,150 (GRCm39) missense probably damaging 1.00
R7373:Lrp2 UTSW 2 69,331,036 (GRCm39) missense probably damaging 1.00
R7446:Lrp2 UTSW 2 69,290,018 (GRCm39) missense probably damaging 0.99
R7446:Lrp2 UTSW 2 69,262,557 (GRCm39) missense probably damaging 1.00
R7451:Lrp2 UTSW 2 69,343,677 (GRCm39) missense probably damaging 1.00
R7492:Lrp2 UTSW 2 69,367,925 (GRCm39) missense probably damaging 0.99
R7571:Lrp2 UTSW 2 69,346,747 (GRCm39) missense probably damaging 1.00
R7638:Lrp2 UTSW 2 69,307,352 (GRCm39) critical splice donor site probably null
R7664:Lrp2 UTSW 2 69,337,076 (GRCm39) missense probably damaging 1.00
R7686:Lrp2 UTSW 2 69,319,581 (GRCm39) missense probably damaging 1.00
R7711:Lrp2 UTSW 2 69,309,687 (GRCm39) critical splice acceptor site probably null
R7737:Lrp2 UTSW 2 69,326,782 (GRCm39) missense possibly damaging 0.77
R7763:Lrp2 UTSW 2 69,333,732 (GRCm39) missense probably damaging 0.99
R7775:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7824:Lrp2 UTSW 2 69,331,883 (GRCm39) missense possibly damaging 0.74
R7840:Lrp2 UTSW 2 69,295,128 (GRCm39) missense probably damaging 0.98
R7878:Lrp2 UTSW 2 69,338,153 (GRCm39) missense probably damaging 1.00
R7878:Lrp2 UTSW 2 69,338,154 (GRCm39) missense probably damaging 1.00
R7895:Lrp2 UTSW 2 69,288,823 (GRCm39) missense probably damaging 0.97
R7898:Lrp2 UTSW 2 69,271,710 (GRCm39) missense probably benign 0.00
R7912:Lrp2 UTSW 2 69,259,016 (GRCm39) missense probably benign 0.03
R7923:Lrp2 UTSW 2 69,268,732 (GRCm39) missense possibly damaging 0.75
R7932:Lrp2 UTSW 2 69,256,371 (GRCm39) missense probably benign 0.00
R7940:Lrp2 UTSW 2 69,262,541 (GRCm39) missense possibly damaging 0.91
R7954:Lrp2 UTSW 2 69,333,867 (GRCm39) missense possibly damaging 0.61
R8007:Lrp2 UTSW 2 69,336,849 (GRCm39) missense probably benign 0.02
R8084:Lrp2 UTSW 2 69,339,713 (GRCm39) missense probably damaging 0.97
R8087:Lrp2 UTSW 2 69,278,473 (GRCm39) missense probably damaging 1.00
R8090:Lrp2 UTSW 2 69,295,089 (GRCm39) missense possibly damaging 0.94
R8110:Lrp2 UTSW 2 69,336,797 (GRCm39) missense probably benign
R8129:Lrp2 UTSW 2 69,260,624 (GRCm39) missense possibly damaging 0.75
R8155:Lrp2 UTSW 2 69,313,342 (GRCm39) missense possibly damaging 0.74
R8182:Lrp2 UTSW 2 69,319,673 (GRCm39) missense probably damaging 1.00
R8239:Lrp2 UTSW 2 69,311,611 (GRCm39) nonsense probably null
R8247:Lrp2 UTSW 2 69,261,431 (GRCm39) missense possibly damaging 0.76
R8327:Lrp2 UTSW 2 69,322,268 (GRCm39) missense probably damaging 1.00
R8355:Lrp2 UTSW 2 69,346,828 (GRCm39) missense probably damaging 0.99
R8404:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8427:Lrp2 UTSW 2 69,281,641 (GRCm39) missense probably damaging 0.97
R8463:Lrp2 UTSW 2 69,322,250 (GRCm39) missense probably damaging 1.00
R8502:Lrp2 UTSW 2 69,344,585 (GRCm39) nonsense probably null
R8529:Lrp2 UTSW 2 69,330,986 (GRCm39) missense probably damaging 0.96
R8673:Lrp2 UTSW 2 69,302,804 (GRCm39) missense probably damaging 1.00
R8698:Lrp2 UTSW 2 69,288,767 (GRCm39) missense probably benign 0.37
R8698:Lrp2 UTSW 2 69,278,583 (GRCm39) missense probably benign 0.39
R8708:Lrp2 UTSW 2 69,289,957 (GRCm39) missense probably damaging 1.00
R8716:Lrp2 UTSW 2 69,274,138 (GRCm39) missense probably benign 0.04
R8723:Lrp2 UTSW 2 69,316,648 (GRCm39) missense probably damaging 1.00
R8787:Lrp2 UTSW 2 69,382,745 (GRCm39) missense probably damaging 1.00
R8903:Lrp2 UTSW 2 69,379,382 (GRCm39) missense possibly damaging 0.68
R8944:Lrp2 UTSW 2 69,341,348 (GRCm39) missense probably damaging 1.00
R9069:Lrp2 UTSW 2 69,331,996 (GRCm39) missense probably damaging 1.00
R9076:Lrp2 UTSW 2 69,350,260 (GRCm39) missense probably benign 0.01
R9155:Lrp2 UTSW 2 69,291,713 (GRCm39) nonsense probably null
R9173:Lrp2 UTSW 2 69,299,731 (GRCm39) missense probably damaging 1.00
R9254:Lrp2 UTSW 2 69,333,891 (GRCm39) missense probably benign 0.09
R9256:Lrp2 UTSW 2 69,341,303 (GRCm39) missense probably benign 0.03
R9291:Lrp2 UTSW 2 69,310,379 (GRCm39) missense probably damaging 1.00
R9335:Lrp2 UTSW 2 69,258,983 (GRCm39) missense probably benign 0.01
R9357:Lrp2 UTSW 2 69,336,917 (GRCm39) missense probably damaging 0.99
R9368:Lrp2 UTSW 2 69,357,979 (GRCm39) missense probably damaging 0.99
R9453:Lrp2 UTSW 2 69,288,832 (GRCm39) missense probably damaging 1.00
R9546:Lrp2 UTSW 2 69,287,165 (GRCm39) critical splice donor site probably null
R9554:Lrp2 UTSW 2 69,261,497 (GRCm39) missense probably damaging 1.00
R9597:Lrp2 UTSW 2 69,260,703 (GRCm39) missense probably benign 0.02
R9601:Lrp2 UTSW 2 69,289,928 (GRCm39) missense probably damaging 1.00
R9623:Lrp2 UTSW 2 69,307,423 (GRCm39) missense probably benign 0.09
RF016:Lrp2 UTSW 2 69,339,549 (GRCm39) missense probably benign
X0011:Lrp2 UTSW 2 69,350,342 (GRCm39) missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69,266,944 (GRCm39) missense probably damaging 0.99
Z1176:Lrp2 UTSW 2 69,338,225 (GRCm39) missense possibly damaging 0.88
Z1176:Lrp2 UTSW 2 69,310,386 (GRCm39) missense possibly damaging 0.66
Z1177:Lrp2 UTSW 2 69,326,812 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,302,797 (GRCm39) missense probably benign 0.03
Z1177:Lrp2 UTSW 2 69,281,624 (GRCm39) missense probably damaging 1.00
Z1177:Lrp2 UTSW 2 69,339,633 (GRCm39) missense probably benign 0.00
Z1177:Lrp2 UTSW 2 69,331,985 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTATGGAGGTAGACAATCCCAG -3'
(R):5'- ATAACCCCAGCGTAGGAGACAGTG -3'

Sequencing Primer
(F):5'- agccacacatgatggtacac -3'
(R):5'- tcacttccaatacacagccc -3'
Posted On 2013-09-30