Mutagenetix > Incidental Mutation

Incidental Mutation 'R9302:Rp1'

704983

Institutional Source

Beutler Lab

Gene Symbol

Rp1

Ensembl Gene

ENSMUSG00000025900

Gene Name

retinitis pigmentosa 1 (human)

Synonyms

Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R9302 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3999557-4409241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4346566 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1441 (E1441G)

Ref Sequence

ENSEMBL: ENSMUSP00000027032 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]

AlphaFold

P56716

Predicted Effect

probably damaging
Transcript: ENSMUST00000027032
AA Change: E1441G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: E1441G

Domain	Start	End	E-Value	Type
DCX	30	117	4.37e-39	SMART
low complexity region	120	133	N/A	INTRINSIC
DCX	152	236	7.17e-35	SMART
low complexity region	343	354	N/A	INTRINSIC
low complexity region	403	414	N/A	INTRINSIC
low complexity region	462	473	N/A	INTRINSIC
low complexity region	646	661	N/A	INTRINSIC
low complexity region	1113	1123	N/A	INTRINSIC
low complexity region	1396	1412	N/A	INTRINSIC
low complexity region	1434	1444	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194992

SMART Domains

Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

Domain	Start	End	E-Value	Type
DCX	40	127	4.37e-39	SMART
low complexity region	130	143	N/A	INTRINSIC
DCX	162	246	7.17e-35	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000208660

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aar2	T	C	2: 156,551,036	L115P	probably damaging	Het
Acsl1	T	A	8: 46,530,433	D494E	probably damaging	Het
Adgrl1	T	C	8: 83,929,797	V243A	possibly damaging	Het
Ak9	A	T	10: 41,320,490	I103F		Het
Ank3	C	T	10: 69,926,019		probably benign	Het
Ano4	T	A	10: 88,995,358	I468L	probably benign	Het
Arhgef10l	G	A	4: 140,515,237	S959L	probably benign	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Cfap221	T	C	1: 119,925,635	I776M	probably benign	Het
Col3a1	C	T	1: 45,311,820	Q25*	probably null	Het
Crabp2	C	A	3: 87,952,526	L100I	probably benign	Het
Dnah5	A	G	15: 28,239,886	D463G	probably benign	Het
Dst	T	C	1: 34,225,555	L2602P	probably damaging	Het
Dusp1	A	G	17: 26,507,174	Y182H	probably damaging	Het
Fam160a1	C	A	3: 85,672,634	D755Y	probably damaging	Het
Fras1	T	A	5: 96,534,892	C83S	probably damaging	Het
Frrs1	G	T	3: 116,899,250		probably null	Het
Gcnt3	A	G	9: 70,035,247	L13P	possibly damaging	Het
Gm21188	A	G	13: 120,035,090	I81T	probably benign	Het
Gm8094	T	C	14: 43,075,377	D88G	probably benign	Het
Hfe	C	T	13: 23,706,042	M249I	probably benign	Het
Hipk1	T	C	3: 103,777,783	E172G	probably benign	Het
Iws1	G	A	18: 32,080,160	E214K	possibly damaging	Het
Ltb4r2	A	T	14: 55,762,276	Q118L	probably damaging	Het
Ltbp4	A	T	7: 27,309,056	C1342S	possibly damaging	Het
Lyst	A	G	13: 13,730,362	D3208G	possibly damaging	Het
Mbnl2	A	G	14: 120,385,538	T163A	probably benign	Het
Mre11a	T	A	9: 14,785,530		probably null	Het
Myo15b	A	G	11: 115,885,412	N610D	possibly damaging	Het
Nt5c1b	T	C	12: 10,380,882	S390P	probably damaging	Het
Olfr1115	T	A	2: 87,252,562	F208L	probably benign	Het
Pde3b	A	G	7: 114,523,386	T730A	probably damaging	Het
Pdzd2	G	T	15: 12,374,256	T1931N	possibly damaging	Het
Pla2g15	C	T	8: 106,150,569	A28V	probably benign	Het
Pmfbp1	A	T	8: 109,541,842	D1007V	probably damaging	Het
Polr1a	T	A	6: 71,924,699		probably null	Het
Ppp1r3a	T	C	6: 14,721,892	K312E	probably benign	Het
Prmt5	G	A	14: 54,512,126	T269I	probably benign	Het
Pwp2	A	G	10: 78,173,706	S793P	probably benign	Het
Rbm12b1	C	A	4: 12,146,181	H718N	probably benign	Het
Rfx1	T	A	8: 84,091,033	M512K	possibly damaging	Het
Slc16a6	C	T	11: 109,459,808	V207I	probably benign	Het
Slc6a9	G	A	4: 117,849,399	R7H	possibly damaging	Het
Sptlc1	A	T	13: 53,374,011	V39D	probably benign	Het
Strc	A	T	2: 121,380,855	L3Q	unknown	Het
Svep1	C	T	4: 58,120,565	E823K	possibly damaging	Het
Tat	A	G	8: 109,998,399		probably benign	Het
Thoc1	T	A	18: 9,968,800	N190K	possibly damaging	Het
Tomt	T	C	7: 101,900,619	E154G	probably damaging	Het
Topaz1	T	A	9: 122,788,822	V1228E	possibly damaging	Het
Trim55	G	A	3: 19,672,989	V407M	probably benign	Het
Ttll5	T	A	12: 85,826,564	M5K	possibly damaging	Het
Ugt2a2	A	C	5: 87,462,081	Y380*	probably null	Het
Usp46	A	G	5: 74,003,261	Y272H	probably benign	Het
Vps39	A	T	2: 120,321,044		probably benign	Het
Zfp12	T	A	5: 143,244,666	H281Q	probably damaging	Het
Zfp142	C	A	1: 74,567,143	R1756L	probably damaging	Het
Zmynd10	T	A	9: 107,549,317	I183K	possibly damaging	Het

Other mutations in Rp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Rp1	APN	1	4346746	missense	probably damaging	0.98
IGL00593:Rp1	APN	1	4345403	missense	possibly damaging	0.70
IGL00956:Rp1	APN	1	4352212	missense	probably damaging	1.00
IGL01070:Rp1	APN	1	4345238	missense	probably damaging	1.00
IGL01531:Rp1	APN	1	4348945	missense	probably benign	0.00
IGL01668:Rp1	APN	1	4345718	missense	probably damaging	1.00
IGL01907:Rp1	APN	1	4348507	missense	possibly damaging	0.56
IGL02055:Rp1	APN	1	4352522	missense	probably damaging	1.00
IGL02071:Rp1	APN	1	4345310	missense	possibly damaging	0.46
IGL02128:Rp1	APN	1	4347385	missense	probably damaging	0.99
IGL02244:Rp1	APN	1	4348780	missense	probably benign	0.00
IGL02381:Rp1	APN	1	4352390	missense	probably benign	0.01
IGL02499:Rp1	APN	1	4349048	missense	probably benign	0.17
IGL02619:Rp1	APN	1	4348450	missense	possibly damaging	0.73
IGL02832:Rp1	APN	1	4349713	missense	probably benign	0.03
IGL02861:Rp1	APN	1	4346152	nonsense	probably null
IGL03288:Rp1	APN	1	4349524	missense	possibly damaging	0.88
IGL03290:Rp1	APN	1	4350041	missense	probably damaging	1.00
IGL03303:Rp1	APN	1	4344817	missense	probably damaging	1.00
R0041:Rp1	UTSW	1	4344628	missense	probably benign	0.36
R0111:Rp1	UTSW	1	4344760	missense	probably damaging	1.00
R0363:Rp1	UTSW	1	4347718	missense	probably damaging	1.00
R0440:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R0442:Rp1	UTSW	1	4346747	missense	probably benign	0.09
R0528:Rp1	UTSW	1	4344865	missense	possibly damaging	0.82
R0586:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R0639:Rp1	UTSW	1	4346498	missense	probably benign	0.00
R0856:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0908:Rp1	UTSW	1	4344655	missense	probably benign	0.05
R0968:Rp1	UTSW	1	4345352	missense	probably benign	0.00
R1099:Rp1	UTSW	1	4352290	missense	possibly damaging	0.45
R1242:Rp1	UTSW	1	4344962	missense	probably benign	0.03
R1301:Rp1	UTSW	1	4345936	missense	possibly damaging	0.56
R1327:Rp1	UTSW	1	4347970	missense	probably benign	0.01
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1403:Rp1	UTSW	1	4346297	missense	possibly damaging	0.73
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1406:Rp1	UTSW	1	4351921	missense	possibly damaging	0.88
R1440:Rp1	UTSW	1	4347396	missense	probably damaging	1.00
R1509:Rp1	UTSW	1	4347694	missense	probably damaging	0.98
R1509:Rp1	UTSW	1	4348537	missense	probably benign	0.20
R1538:Rp1	UTSW	1	4345676	missense	probably damaging	1.00
R1609:Rp1	UTSW	1	4349201	missense	probably damaging	1.00
R1666:Rp1	UTSW	1	4349863	missense	probably damaging	1.00
R1703:Rp1	UTSW	1	4345169	missense	probably damaging	1.00
R1782:Rp1	UTSW	1	4349089	missense	probably benign	0.00
R1799:Rp1	UTSW	1	4348832	missense	possibly damaging	0.94
R1848:Rp1	UTSW	1	4347232	missense	possibly damaging	0.76
R1908:Rp1	UTSW	1	4348720	missense	probably damaging	0.99
R1919:Rp1	UTSW	1	4352671	missense	probably damaging	0.99
R2087:Rp1	UTSW	1	4348352	missense	probably damaging	1.00
R2211:Rp1	UTSW	1	4348139	missense	probably damaging	0.96
R2278:Rp1	UTSW	1	4348027	missense	possibly damaging	0.51
R2287:Rp1	UTSW	1	4345959	nonsense	probably null
R2316:Rp1	UTSW	1	4345640	missense	probably damaging	1.00
R2346:Rp1	UTSW	1	4348013	missense	probably damaging	1.00
R2878:Rp1	UTSW	1	4348139	missense	probably damaging	1.00
R3023:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3025:Rp1	UTSW	1	4352675	missense	probably damaging	1.00
R3716:Rp1	UTSW	1	4349765	missense	probably benign	0.38
R3814:Rp1	UTSW	1	4349708	missense	probably benign
R3929:Rp1	UTSW	1	4352645	missense	probably damaging	1.00
R4064:Rp1	UTSW	1	4345400	missense	probably benign	0.08
R4426:Rp1	UTSW	1	4347924	missense	probably benign	0.13
R4557:Rp1	UTSW	1	4344663	missense	possibly damaging	0.61
R4764:Rp1	UTSW	1	4345878	missense	probably damaging	0.96
R4845:Rp1	UTSW	1	4349228	missense	probably benign	0.02
R4850:Rp1	UTSW	1	4348675	missense	probably damaging	1.00
R4857:Rp1	UTSW	1	4352316	missense	probably damaging	0.99
R4857:Rp1	UTSW	1	4352317	missense	probably damaging	1.00
R5159:Rp1	UTSW	1	4346203	missense	possibly damaging	0.73
R5226:Rp1	UTSW	1	4348033	missense	probably benign	0.01
R5327:Rp1	UTSW	1	4349360	splice site	probably null
R5352:Rp1	UTSW	1	4347098	missense	probably benign	0.00
R5504:Rp1	UTSW	1	4349890	missense	probably damaging	1.00
R5527:Rp1	UTSW	1	4346393	missense	possibly damaging	0.75
R5529:Rp1	UTSW	1	4345832	missense	probably benign	0.42
R5569:Rp1	UTSW	1	4345237	missense	probably damaging	1.00
R5622:Rp1	UTSW	1	4347837	missense	possibly damaging	0.76
R5970:Rp1	UTSW	1	4348462	missense	probably benign	0.05
R5992:Rp1	UTSW	1	4148703	missense	unknown
R6004:Rp1	UTSW	1	4197585	missense	unknown
R6018:Rp1	UTSW	1	4352836	missense	possibly damaging	0.83
R6074:Rp1	UTSW	1	4345379	missense	probably benign	0.02
R6127:Rp1	UTSW	1	4349311	missense	possibly damaging	0.80
R6187:Rp1	UTSW	1	4349869	missense	probably damaging	1.00
R6301:Rp1	UTSW	1	4347254	missense	probably benign	0.04
R6317:Rp1	UTSW	1	4041989	missense	unknown
R6405:Rp1	UTSW	1	4345771	missense	probably damaging	1.00
R6445:Rp1	UTSW	1	4226617	missense	unknown
R6466:Rp1	UTSW	1	4347886	missense	probably benign	0.01
R6501:Rp1	UTSW	1	4311280	intron	probably benign
R6547:Rp1	UTSW	1	4170305	missense	unknown
R6604:Rp1	UTSW	1	4019128	missense	unknown
R6700:Rp1	UTSW	1	4349896	missense	probably damaging	1.00
R6706:Rp1	UTSW	1	4142664	missense	unknown
R6831:Rp1	UTSW	1	4349864	splice site	probably null
R6918:Rp1	UTSW	1	3999608	missense	unknown
R6973:Rp1	UTSW	1	4351994	nonsense	probably null
R6981:Rp1	UTSW	1	4345655	missense	probably benign	0.06
R7009:Rp1	UTSW	1	4042068	missense	unknown
R7078:Rp1	UTSW	1	4206791	missense	unknown
R7112:Rp1	UTSW	1	4349018	missense	probably benign	0.43
R7135:Rp1	UTSW	1	4348168	missense	possibly damaging	0.83
R7165:Rp1	UTSW	1	4349917	missense	probably damaging	0.99
R7199:Rp1	UTSW	1	4347290	missense	possibly damaging	0.73
R7232:Rp1	UTSW	1	4228601	missense	unknown
R7367:Rp1	UTSW	1	4347998	missense	probably benign	0.42
R7484:Rp1	UTSW	1	4345481	missense	probably benign	0.10
R7500:Rp1	UTSW	1	4311278	missense	unknown
R7569:Rp1	UTSW	1	4284840	missense	unknown
R7642:Rp1	UTSW	1	4147831	missense	unknown
R7693:Rp1	UTSW	1	4347403	missense	probably damaging	1.00
R7742:Rp1	UTSW	1	4170234	missense	unknown
R7759:Rp1	UTSW	1	4344884	missense	probably benign
R7784:Rp1	UTSW	1	4142658	missense	unknown
R7816:Rp1	UTSW	1	4347703	missense	probably damaging	0.98
R7866:Rp1	UTSW	1	4347701	missense	probably benign	0.02
R8215:Rp1	UTSW	1	4245095	missense	unknown
R8281:Rp1	UTSW	1	4347916	missense	probably damaging	1.00
R8294:Rp1	UTSW	1	4345997	missense	probably benign	0.09
R8309:Rp1	UTSW	1	4347089	missense	probably benign	0.00
R8311:Rp1	UTSW	1	4348349	missense	probably benign	0.11
R8500:Rp1	UTSW	1	4346590	missense	possibly damaging	0.91
R8559:Rp1	UTSW	1	4349561	missense	probably damaging	1.00
R8672:Rp1	UTSW	1	4348784	missense	possibly damaging	0.55
R8688:Rp1	UTSW	1	4346405	missense	probably benign	0.01
R8792:Rp1	UTSW	1	4024868	missense	unknown
R8859:Rp1	UTSW	1	4349960	missense	probably benign	0.07
R8945:Rp1	UTSW	1	4349594	missense	probably benign	0.42
R8959:Rp1	UTSW	1	4349427	intron	probably benign
R8979:Rp1	UTSW	1	4148714	missense	unknown
R9126:Rp1	UTSW	1	4346913	missense	probably damaging	0.99
R9156:Rp1	UTSW	1	4163938	missense	unknown
R9160:Rp1	UTSW	1	4346497	missense	probably benign	0.00
R9221:Rp1	UTSW	1	4245043	missense	unknown
R9263:Rp1	UTSW	1	4348452	missense	probably benign	0.25
R9263:Rp1	UTSW	1	4348937	missense	probably benign	0.02
R9318:Rp1	UTSW	1	4348265	missense	probably benign	0.09
R9414:Rp1	UTSW	1	4243618	missense	unknown
R9474:Rp1	UTSW	1	4092615	critical splice donor site	probably null
R9478:Rp1	UTSW	1	4347322	missense	probably benign	0.06
R9529:Rp1	UTSW	1	4346224	missense	probably benign
R9572:Rp1	UTSW	1	4348439	missense	probably benign
R9673:Rp1	UTSW	1	4267569	missense	unknown
R9709:Rp1	UTSW	1	4042032	missense	unknown
R9716:Rp1	UTSW	1	4142610	critical splice donor site	probably null
RF003:Rp1	UTSW	1	4344694	missense	probably damaging	0.99
V1662:Rp1	UTSW	1	4349560	missense	probably damaging	1.00
X0012:Rp1	UTSW	1	4347695	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGTCTCCAGAATGGCAGTATTTC -3'
(R):5'- GTTAAGTTCCCAACGCACTC -3'

Sequencing Primer
(F):5'- AGAATGGCAGTATTTCTTCTTTCCTG -3'
(R):5'- TTAAGTTCCCAACGCACTCTCCTAAG -3'

Posted On

2022-03-25