Incidental Mutation 'R9302:Rp1'
ID 704983
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9302 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 4185896-4479508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4416789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1441 (E1441G)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect probably damaging
Transcript: ENSMUST00000027032
AA Change: E1441G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: E1441G

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,392,956 (GRCm39) L115P probably damaging Het
Acsl1 T A 8: 46,983,470 (GRCm39) D494E probably damaging Het
Adgrl1 T C 8: 84,656,426 (GRCm39) V243A possibly damaging Het
Ak9 A T 10: 41,196,486 (GRCm39) I103F Het
Ank3 C T 10: 69,761,849 (GRCm39) probably benign Het
Ano4 T A 10: 88,831,220 (GRCm39) I468L probably benign Het
Anxa2r1 A G 13: 120,496,626 (GRCm39) I81T probably benign Het
Arhgef10l G A 4: 140,242,548 (GRCm39) S959L probably benign Het
Cdh23 G A 10: 60,143,306 (GRCm39) A3005V possibly damaging Het
Cfap221 T C 1: 119,853,365 (GRCm39) I776M probably benign Het
Col3a1 C T 1: 45,350,980 (GRCm39) Q25* probably null Het
Crabp2 C A 3: 87,859,833 (GRCm39) L100I probably benign Het
Dnah5 A G 15: 28,240,032 (GRCm39) D463G probably benign Het
Dst T C 1: 34,264,636 (GRCm39) L2602P probably damaging Het
Dusp1 A G 17: 26,726,148 (GRCm39) Y182H probably damaging Het
Fhip1a C A 3: 85,579,941 (GRCm39) D755Y probably damaging Het
Fras1 T A 5: 96,682,751 (GRCm39) C83S probably damaging Het
Frrs1 G T 3: 116,692,899 (GRCm39) probably null Het
Gcnt3 A G 9: 69,942,529 (GRCm39) L13P possibly damaging Het
Gm8094 T C 14: 42,932,834 (GRCm39) D88G probably benign Het
Hfe C T 13: 23,890,025 (GRCm39) M249I probably benign Het
Hipk1 T C 3: 103,685,099 (GRCm39) E172G probably benign Het
Iws1 G A 18: 32,213,213 (GRCm39) E214K possibly damaging Het
Ltb4r2 A T 14: 55,999,733 (GRCm39) Q118L probably damaging Het
Ltbp4 A T 7: 27,008,481 (GRCm39) C1342S possibly damaging Het
Lyst A G 13: 13,904,947 (GRCm39) D3208G possibly damaging Het
Mbnl2 A G 14: 120,622,950 (GRCm39) T163A probably benign Het
Mre11a T A 9: 14,696,826 (GRCm39) probably null Het
Myo15b A G 11: 115,776,238 (GRCm39) N610D possibly damaging Het
Nt5c1b T C 12: 10,430,882 (GRCm39) S390P probably damaging Het
Or10ag53 T A 2: 87,082,906 (GRCm39) F208L probably benign Het
Pde3b A G 7: 114,122,621 (GRCm39) T730A probably damaging Het
Pdzd2 G T 15: 12,374,342 (GRCm39) T1931N possibly damaging Het
Pla2g15 C T 8: 106,877,201 (GRCm39) A28V probably benign Het
Pmfbp1 A T 8: 110,268,474 (GRCm39) D1007V probably damaging Het
Polr1a T A 6: 71,901,683 (GRCm39) probably null Het
Ppp1r3a T C 6: 14,721,891 (GRCm39) K312E probably benign Het
Prmt5 G A 14: 54,749,583 (GRCm39) T269I probably benign Het
Pwp2 A G 10: 78,009,540 (GRCm39) S793P probably benign Het
Rbm12b1 C A 4: 12,146,181 (GRCm39) H718N probably benign Het
Rfx1 T A 8: 84,817,662 (GRCm39) M512K possibly damaging Het
Slc16a6 C T 11: 109,350,634 (GRCm39) V207I probably benign Het
Slc6a9 G A 4: 117,706,596 (GRCm39) R7H possibly damaging Het
Sptlc1 A T 13: 53,528,047 (GRCm39) V39D probably benign Het
Strc A T 2: 121,211,336 (GRCm39) L3Q unknown Het
Svep1 C T 4: 58,120,565 (GRCm39) E823K possibly damaging Het
Tat A G 8: 110,725,031 (GRCm39) probably benign Het
Thoc1 T A 18: 9,968,800 (GRCm39) N190K possibly damaging Het
Tomt T C 7: 101,549,826 (GRCm39) E154G probably damaging Het
Topaz1 T A 9: 122,617,887 (GRCm39) V1228E possibly damaging Het
Trim55 G A 3: 19,727,153 (GRCm39) V407M probably benign Het
Ttll5 T A 12: 85,873,338 (GRCm39) M5K possibly damaging Het
Ugt2a2 A C 5: 87,609,940 (GRCm39) Y380* probably null Het
Usp46 A G 5: 74,163,922 (GRCm39) Y272H probably benign Het
Vps39 A T 2: 120,151,525 (GRCm39) probably benign Het
Zfp12 T A 5: 143,230,421 (GRCm39) H281Q probably damaging Het
Zfp142 C A 1: 74,606,302 (GRCm39) R1756L probably damaging Het
Zmynd10 T A 9: 107,426,516 (GRCm39) I183K possibly damaging Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4,416,969 (GRCm39) missense probably damaging 0.98
IGL00593:Rp1 APN 1 4,415,626 (GRCm39) missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4,422,435 (GRCm39) missense probably damaging 1.00
IGL01070:Rp1 APN 1 4,415,461 (GRCm39) missense probably damaging 1.00
IGL01531:Rp1 APN 1 4,419,168 (GRCm39) missense probably benign 0.00
IGL01668:Rp1 APN 1 4,415,941 (GRCm39) missense probably damaging 1.00
IGL01907:Rp1 APN 1 4,418,730 (GRCm39) missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4,422,745 (GRCm39) missense probably damaging 1.00
IGL02071:Rp1 APN 1 4,415,533 (GRCm39) missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4,417,608 (GRCm39) missense probably damaging 0.99
IGL02244:Rp1 APN 1 4,419,003 (GRCm39) missense probably benign 0.00
IGL02381:Rp1 APN 1 4,422,613 (GRCm39) missense probably benign 0.01
IGL02499:Rp1 APN 1 4,419,271 (GRCm39) missense probably benign 0.17
IGL02619:Rp1 APN 1 4,418,673 (GRCm39) missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4,419,936 (GRCm39) missense probably benign 0.03
IGL02861:Rp1 APN 1 4,416,375 (GRCm39) nonsense probably null
IGL03288:Rp1 APN 1 4,419,747 (GRCm39) missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4,420,264 (GRCm39) missense probably damaging 1.00
IGL03303:Rp1 APN 1 4,415,040 (GRCm39) missense probably damaging 1.00
R0041:Rp1 UTSW 1 4,414,851 (GRCm39) missense probably benign 0.36
R0111:Rp1 UTSW 1 4,414,983 (GRCm39) missense probably damaging 1.00
R0363:Rp1 UTSW 1 4,417,941 (GRCm39) missense probably damaging 1.00
R0440:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R0442:Rp1 UTSW 1 4,416,970 (GRCm39) missense probably benign 0.09
R0528:Rp1 UTSW 1 4,415,088 (GRCm39) missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4,416,721 (GRCm39) missense probably benign 0.00
R0856:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0908:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0968:Rp1 UTSW 1 4,415,575 (GRCm39) missense probably benign 0.00
R1099:Rp1 UTSW 1 4,422,513 (GRCm39) missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4,415,185 (GRCm39) missense probably benign 0.03
R1301:Rp1 UTSW 1 4,416,159 (GRCm39) missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4,418,193 (GRCm39) missense probably benign 0.01
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4,417,619 (GRCm39) missense probably damaging 1.00
R1509:Rp1 UTSW 1 4,418,760 (GRCm39) missense probably benign 0.20
R1509:Rp1 UTSW 1 4,417,917 (GRCm39) missense probably damaging 0.98
R1538:Rp1 UTSW 1 4,415,899 (GRCm39) missense probably damaging 1.00
R1609:Rp1 UTSW 1 4,419,424 (GRCm39) missense probably damaging 1.00
R1666:Rp1 UTSW 1 4,420,086 (GRCm39) missense probably damaging 1.00
R1703:Rp1 UTSW 1 4,415,392 (GRCm39) missense probably damaging 1.00
R1782:Rp1 UTSW 1 4,419,312 (GRCm39) missense probably benign 0.00
R1799:Rp1 UTSW 1 4,419,055 (GRCm39) missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4,417,455 (GRCm39) missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4,418,943 (GRCm39) missense probably damaging 0.99
R1919:Rp1 UTSW 1 4,422,894 (GRCm39) missense probably damaging 0.99
R2087:Rp1 UTSW 1 4,418,575 (GRCm39) missense probably damaging 1.00
R2211:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 0.96
R2278:Rp1 UTSW 1 4,418,250 (GRCm39) missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4,416,182 (GRCm39) nonsense probably null
R2316:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R2346:Rp1 UTSW 1 4,418,236 (GRCm39) missense probably damaging 1.00
R2878:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 1.00
R3023:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3025:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3716:Rp1 UTSW 1 4,419,988 (GRCm39) missense probably benign 0.38
R3814:Rp1 UTSW 1 4,419,931 (GRCm39) missense probably benign
R3929:Rp1 UTSW 1 4,422,868 (GRCm39) missense probably damaging 1.00
R4064:Rp1 UTSW 1 4,415,623 (GRCm39) missense probably benign 0.08
R4426:Rp1 UTSW 1 4,418,147 (GRCm39) missense probably benign 0.13
R4557:Rp1 UTSW 1 4,414,886 (GRCm39) missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4,416,101 (GRCm39) missense probably damaging 0.96
R4845:Rp1 UTSW 1 4,419,451 (GRCm39) missense probably benign 0.02
R4850:Rp1 UTSW 1 4,418,898 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,540 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,539 (GRCm39) missense probably damaging 0.99
R5159:Rp1 UTSW 1 4,416,426 (GRCm39) missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4,418,256 (GRCm39) missense probably benign 0.01
R5327:Rp1 UTSW 1 4,419,583 (GRCm39) splice site probably null
R5352:Rp1 UTSW 1 4,417,321 (GRCm39) missense probably benign 0.00
R5504:Rp1 UTSW 1 4,420,113 (GRCm39) missense probably damaging 1.00
R5527:Rp1 UTSW 1 4,416,616 (GRCm39) missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4,416,055 (GRCm39) missense probably benign 0.42
R5569:Rp1 UTSW 1 4,415,460 (GRCm39) missense probably damaging 1.00
R5622:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4,418,685 (GRCm39) missense probably benign 0.05
R5992:Rp1 UTSW 1 4,218,926 (GRCm39) missense unknown
R6004:Rp1 UTSW 1 4,267,808 (GRCm39) missense unknown
R6018:Rp1 UTSW 1 4,423,059 (GRCm39) missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4,415,602 (GRCm39) missense probably benign 0.02
R6127:Rp1 UTSW 1 4,419,534 (GRCm39) missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4,420,092 (GRCm39) missense probably damaging 1.00
R6301:Rp1 UTSW 1 4,417,477 (GRCm39) missense probably benign 0.04
R6317:Rp1 UTSW 1 4,112,212 (GRCm39) missense unknown
R6405:Rp1 UTSW 1 4,415,994 (GRCm39) missense probably damaging 1.00
R6445:Rp1 UTSW 1 4,296,840 (GRCm39) missense unknown
R6466:Rp1 UTSW 1 4,418,109 (GRCm39) missense probably benign 0.01
R6501:Rp1 UTSW 1 4,381,503 (GRCm39) intron probably benign
R6547:Rp1 UTSW 1 4,240,528 (GRCm39) missense unknown
R6604:Rp1 UTSW 1 4,089,351 (GRCm39) missense unknown
R6700:Rp1 UTSW 1 4,420,119 (GRCm39) missense probably damaging 1.00
R6706:Rp1 UTSW 1 4,212,887 (GRCm39) missense unknown
R6831:Rp1 UTSW 1 4,420,087 (GRCm39) splice site probably null
R6918:Rp1 UTSW 1 4,069,831 (GRCm39) missense unknown
R6973:Rp1 UTSW 1 4,422,217 (GRCm39) nonsense probably null
R6981:Rp1 UTSW 1 4,415,878 (GRCm39) missense probably benign 0.06
R7009:Rp1 UTSW 1 4,112,291 (GRCm39) missense unknown
R7078:Rp1 UTSW 1 4,277,014 (GRCm39) missense unknown
R7112:Rp1 UTSW 1 4,419,241 (GRCm39) missense probably benign 0.43
R7135:Rp1 UTSW 1 4,418,391 (GRCm39) missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4,420,140 (GRCm39) missense probably damaging 0.99
R7199:Rp1 UTSW 1 4,417,513 (GRCm39) missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4,298,824 (GRCm39) missense unknown
R7367:Rp1 UTSW 1 4,418,221 (GRCm39) missense probably benign 0.42
R7484:Rp1 UTSW 1 4,415,704 (GRCm39) missense probably benign 0.10
R7500:Rp1 UTSW 1 4,381,501 (GRCm39) missense unknown
R7569:Rp1 UTSW 1 4,355,063 (GRCm39) missense unknown
R7642:Rp1 UTSW 1 4,218,054 (GRCm39) missense unknown
R7693:Rp1 UTSW 1 4,417,626 (GRCm39) missense probably damaging 1.00
R7742:Rp1 UTSW 1 4,240,457 (GRCm39) missense unknown
R7759:Rp1 UTSW 1 4,415,107 (GRCm39) missense probably benign
R7784:Rp1 UTSW 1 4,212,881 (GRCm39) missense unknown
R7816:Rp1 UTSW 1 4,417,926 (GRCm39) missense probably damaging 0.98
R7866:Rp1 UTSW 1 4,417,924 (GRCm39) missense probably benign 0.02
R8215:Rp1 UTSW 1 4,315,318 (GRCm39) missense unknown
R8281:Rp1 UTSW 1 4,418,139 (GRCm39) missense probably damaging 1.00
R8294:Rp1 UTSW 1 4,416,220 (GRCm39) missense probably benign 0.09
R8309:Rp1 UTSW 1 4,417,312 (GRCm39) missense probably benign 0.00
R8311:Rp1 UTSW 1 4,418,572 (GRCm39) missense probably benign 0.11
R8500:Rp1 UTSW 1 4,416,813 (GRCm39) missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4,419,784 (GRCm39) missense probably damaging 1.00
R8672:Rp1 UTSW 1 4,419,007 (GRCm39) missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4,416,628 (GRCm39) missense probably benign 0.01
R8792:Rp1 UTSW 1 4,095,091 (GRCm39) missense unknown
R8859:Rp1 UTSW 1 4,420,183 (GRCm39) missense probably benign 0.07
R8945:Rp1 UTSW 1 4,419,817 (GRCm39) missense probably benign 0.42
R8959:Rp1 UTSW 1 4,419,650 (GRCm39) intron probably benign
R8979:Rp1 UTSW 1 4,218,937 (GRCm39) missense unknown
R9126:Rp1 UTSW 1 4,417,136 (GRCm39) missense probably damaging 0.99
R9156:Rp1 UTSW 1 4,234,161 (GRCm39) missense unknown
R9160:Rp1 UTSW 1 4,416,720 (GRCm39) missense probably benign 0.00
R9221:Rp1 UTSW 1 4,315,266 (GRCm39) missense unknown
R9263:Rp1 UTSW 1 4,419,160 (GRCm39) missense probably benign 0.02
R9263:Rp1 UTSW 1 4,418,675 (GRCm39) missense probably benign 0.25
R9318:Rp1 UTSW 1 4,418,488 (GRCm39) missense probably benign 0.09
R9414:Rp1 UTSW 1 4,313,841 (GRCm39) missense unknown
R9474:Rp1 UTSW 1 4,162,838 (GRCm39) critical splice donor site probably null
R9478:Rp1 UTSW 1 4,417,545 (GRCm39) missense probably benign 0.06
R9529:Rp1 UTSW 1 4,416,447 (GRCm39) missense probably benign
R9572:Rp1 UTSW 1 4,418,662 (GRCm39) missense probably benign
R9673:Rp1 UTSW 1 4,337,792 (GRCm39) missense unknown
R9709:Rp1 UTSW 1 4,112,255 (GRCm39) missense unknown
R9716:Rp1 UTSW 1 4,212,833 (GRCm39) critical splice donor site probably null
RF003:Rp1 UTSW 1 4,414,917 (GRCm39) missense probably damaging 0.99
V1662:Rp1 UTSW 1 4,419,783 (GRCm39) missense probably damaging 1.00
X0012:Rp1 UTSW 1 4,417,918 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCTCCAGAATGGCAGTATTTC -3'
(R):5'- GTTAAGTTCCCAACGCACTC -3'

Sequencing Primer
(F):5'- AGAATGGCAGTATTTCTTCTTTCCTG -3'
(R):5'- TTAAGTTCCCAACGCACTCTCCTAAG -3'
Posted On 2022-03-25