Mutagenetix > Incidental Mutation

Incidental Mutation 'R9302:Strc'

704989

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R9302 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121380855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 3 (L3Q)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389]

AlphaFold

Q8VIM6

Predicted Effect

unknown
Transcript: ENSMUST00000038389
AA Change: L3Q

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: L3Q

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aar2	T	C	2: 156,551,036	L115P	probably damaging	Het
Acsl1	T	A	8: 46,530,433	D494E	probably damaging	Het
Adgrl1	T	C	8: 83,929,797	V243A	possibly damaging	Het
Ak9	A	T	10: 41,320,490	I103F		Het
Ank3	C	T	10: 69,926,019		probably benign	Het
Ano4	T	A	10: 88,995,358	I468L	probably benign	Het
Arhgef10l	G	A	4: 140,515,237	S959L	probably benign	Het
Cdh23	G	A	10: 60,307,527	A3005V	possibly damaging	Het
Cfap221	T	C	1: 119,925,635	I776M	probably benign	Het
Col3a1	C	T	1: 45,311,820	Q25*	probably null	Het
Crabp2	C	A	3: 87,952,526	L100I	probably benign	Het
Dnah5	A	G	15: 28,239,886	D463G	probably benign	Het
Dst	T	C	1: 34,225,555	L2602P	probably damaging	Het
Dusp1	A	G	17: 26,507,174	Y182H	probably damaging	Het
Fam160a1	C	A	3: 85,672,634	D755Y	probably damaging	Het
Fras1	T	A	5: 96,534,892	C83S	probably damaging	Het
Frrs1	G	T	3: 116,899,250		probably null	Het
Gcnt3	A	G	9: 70,035,247	L13P	possibly damaging	Het
Gm21188	A	G	13: 120,035,090	I81T	probably benign	Het
Gm8094	T	C	14: 43,075,377	D88G	probably benign	Het
Hfe	C	T	13: 23,706,042	M249I	probably benign	Het
Hipk1	T	C	3: 103,777,783	E172G	probably benign	Het
Iws1	G	A	18: 32,080,160	E214K	possibly damaging	Het
Ltb4r2	A	T	14: 55,762,276	Q118L	probably damaging	Het
Ltbp4	A	T	7: 27,309,056	C1342S	possibly damaging	Het
Lyst	A	G	13: 13,730,362	D3208G	possibly damaging	Het
Mbnl2	A	G	14: 120,385,538	T163A	probably benign	Het
Mre11a	T	A	9: 14,785,530		probably null	Het
Myo15b	A	G	11: 115,885,412	N610D	possibly damaging	Het
Nt5c1b	T	C	12: 10,380,882	S390P	probably damaging	Het
Olfr1115	T	A	2: 87,252,562	F208L	probably benign	Het
Pde3b	A	G	7: 114,523,386	T730A	probably damaging	Het
Pdzd2	G	T	15: 12,374,256	T1931N	possibly damaging	Het
Pla2g15	C	T	8: 106,150,569	A28V	probably benign	Het
Pmfbp1	A	T	8: 109,541,842	D1007V	probably damaging	Het
Polr1a	T	A	6: 71,924,699		probably null	Het
Ppp1r3a	T	C	6: 14,721,892	K312E	probably benign	Het
Prmt5	G	A	14: 54,512,126	T269I	probably benign	Het
Pwp2	A	G	10: 78,173,706	S793P	probably benign	Het
Rbm12b1	C	A	4: 12,146,181	H718N	probably benign	Het
Rfx1	T	A	8: 84,091,033	M512K	possibly damaging	Het
Rp1	T	C	1: 4,346,566	E1441G	probably damaging	Het
Slc16a6	C	T	11: 109,459,808	V207I	probably benign	Het
Slc6a9	G	A	4: 117,849,399	R7H	possibly damaging	Het
Sptlc1	A	T	13: 53,374,011	V39D	probably benign	Het
Svep1	C	T	4: 58,120,565	E823K	possibly damaging	Het
Tat	A	G	8: 109,998,399		probably benign	Het
Thoc1	T	A	18: 9,968,800	N190K	possibly damaging	Het
Tomt	T	C	7: 101,900,619	E154G	probably damaging	Het
Topaz1	T	A	9: 122,788,822	V1228E	possibly damaging	Het
Trim55	G	A	3: 19,672,989	V407M	probably benign	Het
Ttll5	T	A	12: 85,826,564	M5K	possibly damaging	Het
Ugt2a2	A	C	5: 87,462,081	Y380*	probably null	Het
Usp46	A	G	5: 74,003,261	Y272H	probably benign	Het
Vps39	A	T	2: 120,321,044		probably benign	Het
Zfp12	T	A	5: 143,244,666	H281Q	probably damaging	Het
Zfp142	C	A	1: 74,567,143	R1756L	probably damaging	Het
Zmynd10	T	A	9: 107,549,317	I183K	possibly damaging	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7018:Strc	UTSW	2	121369058	missense	probably damaging	1.00
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACCAGTTTTAAAAGGAGGGC -3'
(R):5'- ATCAGGTGTTCAGTGGCTCC -3'

Sequencing Primer
(F):5'- GTTCAATTCCCAGCAACTACATGGTG -3'
(R):5'- TTCAGTGGCTCCGGTGACAG -3'

Posted On

2022-03-25