Incidental Mutation 'R0737:Olfr1209'
ID70500
Institutional Source Beutler Lab
Gene Symbol Olfr1209
Ensembl Gene ENSMUSG00000075113
Gene Nameolfactory receptor 1209
SynonymsMOR230-7, GA_x6K02T2Q125-50386882-50385950
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88904942-88915157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88910273 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 40 (N40S)
Ref Sequence ENSEMBL: ENSMUSP00000150607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099809] [ENSMUST00000213136]
Predicted Effect probably damaging
Transcript: ENSMUST00000099809
AA Change: N40S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097397
Gene: ENSMUSG00000075113
AA Change: N40S

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 32 300 1.3e-5 PFAM
Pfam:7tm_1 39 285 7.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213136
AA Change: N40S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213240
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Olfr1209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03103:Olfr1209 APN 2 88910178 missense probably benign 0.18
R0179:Olfr1209 UTSW 2 88909893 missense possibly damaging 0.62
R0245:Olfr1209 UTSW 2 88909875 missense possibly damaging 0.72
R2168:Olfr1209 UTSW 2 88910178 missense probably damaging 0.99
R2311:Olfr1209 UTSW 2 88909469 missense probably benign 0.00
R3429:Olfr1209 UTSW 2 88909466 missense probably benign
R3430:Olfr1209 UTSW 2 88909466 missense probably benign
R3876:Olfr1209 UTSW 2 88909608 missense possibly damaging 0.96
R5717:Olfr1209 UTSW 2 88910022 missense possibly damaging 0.57
R6029:Olfr1209 UTSW 2 88910036 missense probably damaging 1.00
R6154:Olfr1209 UTSW 2 88910390 start codon destroyed probably null 1.00
R7188:Olfr1209 UTSW 2 88909859 missense probably damaging 1.00
R7197:Olfr1209 UTSW 2 88910364 missense probably benign 0.01
R7744:Olfr1209 UTSW 2 88909659 missense possibly damaging 0.45
R8913:Olfr1209 UTSW 2 88909647 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTCATGTAGTGCAGGGGCTTACAG -3'
(R):5'- CCATTTCTGGGACTCATAACAGGGC -3'

Sequencing Primer
(F):5'- TATCGGTCCACAGCCATGAG -3'
(R):5'- CTTGGTTTGACACAGGATCCT -3'
Posted On2013-09-30