Incidental Mutation 'R9303:Knl1'
ID 705047
Institutional Source Beutler Lab
Gene Symbol Knl1
Ensembl Gene ENSMUSG00000027326
Gene Name kinetochore scaffold 1
Synonyms 2310043D08Rik, 5730505K17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9303 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 119047119-119105501 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119068348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 177 (C177R)
Ref Sequence ENSEMBL: ENSMUSP00000118646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028799] [ENSMUST00000028802] [ENSMUST00000099542] [ENSMUST00000152380] [ENSMUST00000153300]
AlphaFold Q66JQ7
Predicted Effect possibly damaging
Transcript: ENSMUST00000028799
AA Change: C177R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028799
Gene: ENSMUSG00000027326
AA Change: C177R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 1e-13 PDB
low complexity region 426 433 N/A INTRINSIC
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000028802
AA Change: C177R

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028802
Gene: ENSMUSG00000027326
AA Change: C177R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000099542
AA Change: C177R

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097140
Gene: ENSMUSG00000027326
AA Change: C177R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
internal_repeat_1 98 304 1.57e-6 PROSPERO
low complexity region 426 433 N/A INTRINSIC
internal_repeat_1 610 824 1.57e-6 PROSPERO
low complexity region 883 894 N/A INTRINSIC
low complexity region 1148 1159 N/A INTRINSIC
low complexity region 1621 1644 N/A INTRINSIC
coiled coil region 1724 1755 N/A INTRINSIC
low complexity region 1836 1850 N/A INTRINSIC
low complexity region 1864 1878 N/A INTRINSIC
PDB:4NF9|B 1899 2119 1e-115 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000152380
AA Change: C177R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118646
Gene: ENSMUSG00000027326
AA Change: C177R

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
PDB:4A1G|H 126 175 3e-14 PDB
low complexity region 426 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153300
SMART Domains Protein: ENSMUSP00000120905
Gene: ENSMUSG00000027326

DomainStartEndE-ValueType
low complexity region 49 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the multiprotein assembly that is required for creation of kinetochore-microtubule attachments and chromosome segregation. The encoded protein functions as a scaffold for proteins that influence the spindle assembly checkpoint during the eukaryotic cell cycle and it interacts with at least five different kinetochore proteins and two checkpoint kinases. In adults, this gene is predominantly expressed in normal testes, various cancer cell lines and primary tumors from other tissues and is ubiquitously expressed in fetal tissues. This gene was originally identified as a fusion partner with the mixed-lineage leukemia (MLL) gene in t(11;15)(q23;q14). Mutations in this gene cause autosomal recessive primary microcephaly-4 (MCPH4). Alternative splicing results in multiple transcript variants encoding different isoforms. Additional splice variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E6. Mice homozygous for an ENU-induced allele exhibit possible embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,500,305 C219* probably null Het
4932438A13Rik A G 3: 37,044,820 I1277V Het
Abca16 A G 7: 120,527,766 I1227V probably benign Het
Adamts17 T C 7: 66,839,897 L21P probably damaging Het
Adcy1 T C 11: 7,144,766 V564A probably damaging Het
Adgre1 A G 17: 57,441,275 N492D probably benign Het
Aldh1b1 G A 4: 45,803,811 V450M probably damaging Het
Arv1 T A 8: 124,730,946 H196Q probably damaging Het
Atp9a A T 2: 168,675,243 I390N probably benign Het
Capn10 T C 1: 92,943,943 probably null Het
Casq2 A G 3: 102,145,384 D404G unknown Het
Cenpf T C 1: 189,660,074 probably null Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Chmp4c T G 3: 10,389,914 S214A probably benign Het
Chrna5 T C 9: 55,004,872 F319L probably benign Het
Csmd1 G T 8: 15,961,532 T2507K probably benign Het
Ctnnd2 T C 15: 30,966,891 M996T probably damaging Het
Dbf4 T C 5: 8,398,102 T328A unknown Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Fat1 T A 8: 45,010,461 W1347R probably damaging Het
Fbxw21 A G 9: 109,157,659 F51L probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gng2 G T 14: 19,875,893 H44N probably damaging Het
Hps5 G A 7: 46,789,195 T38I possibly damaging Het
Igf2 G A 7: 142,654,416 R64C probably damaging Het
Inpp4b C T 8: 82,033,129 A601V probably damaging Het
Kdm2a A G 19: 4,345,578 Y342H probably benign Het
Kidins220 C A 12: 25,057,111 T1430K probably benign Het
Krt32 T C 11: 100,081,203 T440A probably benign Het
Kynu T A 2: 43,679,756 F350Y probably damaging Het
Lama4 T C 10: 39,097,141 L1568P probably damaging Het
Lrp1b A T 2: 41,728,562 S281T Het
Olfr131 A T 17: 38,082,738 V80D probably damaging Het
Olfr191 A G 16: 59,086,439 S15P probably benign Het
Olfr897-ps1 C T 9: 38,309,167 T124M probably benign Het
Orc3 G A 4: 34,607,181 R50* probably null Het
Osbpl6 T A 2: 76,548,372 D124E probably damaging Het
Parp4 TG T 14: 56,595,333 probably null Het
Parp4 T C 14: 56,614,767 probably null Het
Pcdhb18 A C 18: 37,491,951 H778P probably benign Het
Polg A T 7: 79,456,112 Y710N probably benign Het
Ppp2r2b C A 18: 42,645,960 R370L possibly damaging Het
Raet1e C T 10: 22,181,973 T213I possibly damaging Het
Reln T A 5: 21,988,707 S1418C possibly damaging Het
Reln T C 5: 22,080,691 S427G probably benign Het
Rhobtb2 G A 14: 69,787,927 H633Y probably damaging Het
Serpina3i T C 12: 104,268,622 V404A probably damaging Het
Serpinb8 T C 1: 107,599,039 probably null Het
Sorl1 G T 9: 41,989,443 Q1658K probably damaging Het
Tmem26 G A 10: 68,723,986 W29* probably null Het
Togaram2 A G 17: 71,689,413 E137G probably damaging Het
Ttc39b A G 4: 83,232,786 L524S probably damaging Het
Usp43 T C 11: 67,876,519 N675S probably damaging Het
Vmn2r104 A G 17: 20,048,177 L10P possibly damaging Het
Zbtb1 G A 12: 76,385,999 R253Q probably damaging Het
Zfp354b T A 11: 50,929,429 R36S probably damaging Het
Other mutations in Knl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Knl1 APN 2 119064083 missense probably damaging 0.96
IGL00582:Knl1 APN 2 119102499 missense probably benign 0.19
IGL00666:Knl1 APN 2 119070464 missense probably damaging 0.96
IGL01062:Knl1 APN 2 119076980 missense probably benign 0.33
IGL01395:Knl1 APN 2 119071566 missense probably damaging 0.96
IGL01604:Knl1 APN 2 119070001 missense probably damaging 1.00
IGL01996:Knl1 APN 2 119104061 missense probably damaging 1.00
IGL02086:Knl1 APN 2 119100774 missense probably benign 0.40
IGL02105:Knl1 APN 2 119071808 missense probably benign
IGL02106:Knl1 APN 2 119072008 missense possibly damaging 0.89
IGL02201:Knl1 APN 2 119069152 missense probably benign 0.01
IGL02252:Knl1 APN 2 119072540 missense probably damaging 1.00
IGL02414:Knl1 APN 2 119070323 missense possibly damaging 0.83
IGL02655:Knl1 APN 2 119070992 missense possibly damaging 0.62
IGL02682:Knl1 APN 2 119077969 missense possibly damaging 0.86
IGL02710:Knl1 APN 2 119070930 missense probably damaging 0.99
IGL02877:Knl1 APN 2 119088831 missense probably benign 0.08
IGL03100:Knl1 APN 2 119100770 missense probably damaging 0.99
IGL03210:Knl1 APN 2 119070617 missense probably benign 0.02
IGL03138:Knl1 UTSW 2 119072359 missense probably damaging 0.96
R0023:Knl1 UTSW 2 119102549 missense possibly damaging 0.73
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0064:Knl1 UTSW 2 119076243 missense probably benign 0.00
R0078:Knl1 UTSW 2 119069892 missense probably benign 0.16
R0178:Knl1 UTSW 2 119058405 splice site probably benign
R0295:Knl1 UTSW 2 119088839 missense probably damaging 1.00
R0433:Knl1 UTSW 2 119104061 missense probably damaging 0.96
R0453:Knl1 UTSW 2 119068388 missense probably damaging 1.00
R0569:Knl1 UTSW 2 119097435 missense possibly damaging 0.95
R0827:Knl1 UTSW 2 119088901 splice site probably benign
R0920:Knl1 UTSW 2 119069828 missense probably benign 0.00
R1120:Knl1 UTSW 2 119062375 missense probably damaging 0.99
R1155:Knl1 UTSW 2 119071154 missense possibly damaging 0.90
R1204:Knl1 UTSW 2 119071189 missense probably benign 0.00
R1241:Knl1 UTSW 2 119072573 missense probably benign 0.03
R1387:Knl1 UTSW 2 119070730 missense possibly damaging 0.93
R1448:Knl1 UTSW 2 119068307 missense probably damaging 1.00
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1469:Knl1 UTSW 2 119071346 missense possibly damaging 0.73
R1719:Knl1 UTSW 2 119071738 missense probably benign 0.01
R1721:Knl1 UTSW 2 119076334 missense probably damaging 1.00
R2128:Knl1 UTSW 2 119071819 missense possibly damaging 0.79
R2170:Knl1 UTSW 2 119087594 critical splice donor site probably null
R2227:Knl1 UTSW 2 119072000 missense probably damaging 0.97
R2246:Knl1 UTSW 2 119072227 missense probably damaging 1.00
R2275:Knl1 UTSW 2 119072281 missense probably damaging 0.99
R2508:Knl1 UTSW 2 119058368 nonsense probably null
R3115:Knl1 UTSW 2 119070391 missense possibly damaging 0.53
R3122:Knl1 UTSW 2 119068944 missense probably benign 0.32
R3431:Knl1 UTSW 2 119062362 missense probably damaging 1.00
R3755:Knl1 UTSW 2 119102579 missense probably damaging 1.00
R4461:Knl1 UTSW 2 119059599 missense probably benign 0.00
R4600:Knl1 UTSW 2 119070544 missense possibly damaging 0.90
R4713:Knl1 UTSW 2 119069137 nonsense probably null
R4758:Knl1 UTSW 2 119071732 frame shift probably null
R4762:Knl1 UTSW 2 119071936 missense probably benign 0.01
R4869:Knl1 UTSW 2 119072351 missense possibly damaging 0.73
R4870:Knl1 UTSW 2 119081513 missense probably benign 0.22
R4935:Knl1 UTSW 2 119068957 missense possibly damaging 0.50
R5167:Knl1 UTSW 2 119070031 missense probably damaging 1.00
R5184:Knl1 UTSW 2 119069176 missense probably damaging 1.00
R5293:Knl1 UTSW 2 119069695 missense probably damaging 0.99
R5326:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5331:Knl1 UTSW 2 119070255 missense possibly damaging 0.92
R5353:Knl1 UTSW 2 119070983 missense probably benign 0.01
R5493:Knl1 UTSW 2 119068730 missense probably damaging 0.98
R5542:Knl1 UTSW 2 119068348 missense possibly damaging 0.66
R5632:Knl1 UTSW 2 119070352 missense probably damaging 1.00
R5650:Knl1 UTSW 2 119081550 nonsense probably null
R5854:Knl1 UTSW 2 119070403 missense probably benign 0.02
R5979:Knl1 UTSW 2 119069360 missense possibly damaging 0.83
R6086:Knl1 UTSW 2 119094068 missense probably damaging 1.00
R6283:Knl1 UTSW 2 119070286 missense probably damaging 1.00
R6285:Knl1 UTSW 2 119071941 missense probably damaging 1.00
R6313:Knl1 UTSW 2 119069318 missense probably damaging 1.00
R6419:Knl1 UTSW 2 119069003 missense probably benign 0.02
R6608:Knl1 UTSW 2 119086612 missense probably damaging 0.99
R6881:Knl1 UTSW 2 119095184 missense possibly damaging 0.67
R7161:Knl1 UTSW 2 119070785 missense possibly damaging 0.79
R7206:Knl1 UTSW 2 119069299 missense probably benign 0.35
R7270:Knl1 UTSW 2 119102522 missense possibly damaging 0.53
R7276:Knl1 UTSW 2 119071686 missense probably damaging 0.98
R7358:Knl1 UTSW 2 119070559 missense possibly damaging 0.92
R7402:Knl1 UTSW 2 119095226 nonsense probably null
R7408:Knl1 UTSW 2 119070592 missense possibly damaging 0.54
R7475:Knl1 UTSW 2 119087546 missense probably damaging 1.00
R7516:Knl1 UTSW 2 119070698 missense probably damaging 0.99
R7524:Knl1 UTSW 2 119065979 missense probably damaging 1.00
R7559:Knl1 UTSW 2 119094006 missense possibly damaging 0.84
R7607:Knl1 UTSW 2 119095133 missense possibly damaging 0.93
R7745:Knl1 UTSW 2 119071556 missense probably benign 0.13
R7847:Knl1 UTSW 2 119070976 missense probably benign 0.02
R8423:Knl1 UTSW 2 119070032 missense probably damaging 1.00
R8725:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8727:Knl1 UTSW 2 119069043 missense probably benign 0.34
R8995:Knl1 UTSW 2 119072509 missense probably benign 0.11
R9023:Knl1 UTSW 2 119070280 missense probably benign 0.27
R9100:Knl1 UTSW 2 119068988 missense probably benign 0.02
R9102:Knl1 UTSW 2 119087492 missense probably benign 0.22
R9400:Knl1 UTSW 2 119100743 missense probably damaging 0.98
R9426:Knl1 UTSW 2 119069498 missense possibly damaging 0.81
R9583:Knl1 UTSW 2 119057301 missense probably damaging 1.00
R9616:Knl1 UTSW 2 119069513 missense probably benign 0.02
R9616:Knl1 UTSW 2 119076944 missense probably damaging 1.00
R9671:Knl1 UTSW 2 119070608 missense probably damaging 1.00
R9766:Knl1 UTSW 2 119069900 missense probably damaging 1.00
R9782:Knl1 UTSW 2 119069429 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCTCAATTACAGACTGCAACCATG -3'
(R):5'- CATTTGATATGTTGAAGAGGCACTG -3'

Sequencing Primer
(F):5'- TTACAGACTGCAACCATGAAAGG -3'
(R):5'- GCACTGTTTGAGTCTTTGGAATAAAC -3'
Posted On 2022-03-25