Incidental Mutation 'R9303:Chmp4c'
ID 705049
Institutional Source Beutler Lab
Gene Symbol Chmp4c
Ensembl Gene ENSMUSG00000027536
Gene Name charged multivesicular body protein 4C
Synonyms Snf7-3, chromatin modifying protein 4C, 2310010I16Rik, 2210015K02Rik, 2010012P02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9303 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 10366907-10428856 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 10389914 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 214 (S214A)
Ref Sequence ENSEMBL: ENSMUSP00000029049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029049] [ENSMUST00000191826]
AlphaFold Q9D7F7
Predicted Effect probably benign
Transcript: ENSMUST00000029049
AA Change: S214A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029049
Gene: ENSMUSG00000027536
AA Change: S214A

DomainStartEndE-ValueType
Pfam:Snf7 24 193 3.3e-55 PFAM
low complexity region 209 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191826
SMART Domains Protein: ENSMUSP00000141606
Gene: ENSMUSG00000027536

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
PDB:4ABM|D 29 64 3e-10 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CHMP4C belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,500,305 C219* probably null Het
4932438A13Rik A G 3: 37,044,820 I1277V Het
Abca16 A G 7: 120,527,766 I1227V probably benign Het
Adamts17 T C 7: 66,839,897 L21P probably damaging Het
Adcy1 T C 11: 7,144,766 V564A probably damaging Het
Adgre1 A G 17: 57,441,275 N492D probably benign Het
Aldh1b1 G A 4: 45,803,811 V450M probably damaging Het
Arv1 T A 8: 124,730,946 H196Q probably damaging Het
Atp9a A T 2: 168,675,243 I390N probably benign Het
Capn10 T C 1: 92,943,943 probably null Het
Casq2 A G 3: 102,145,384 D404G unknown Het
Cenpf T C 1: 189,660,074 probably null Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Chrna5 T C 9: 55,004,872 F319L probably benign Het
Csmd1 G T 8: 15,961,532 T2507K probably benign Het
Ctnnd2 T C 15: 30,966,891 M996T probably damaging Het
Dbf4 T C 5: 8,398,102 T328A unknown Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Fat1 T A 8: 45,010,461 W1347R probably damaging Het
Fbxw21 A G 9: 109,157,659 F51L probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gng2 G T 14: 19,875,893 H44N probably damaging Het
Hps5 G A 7: 46,789,195 T38I possibly damaging Het
Igf2 G A 7: 142,654,416 R64C probably damaging Het
Inpp4b C T 8: 82,033,129 A601V probably damaging Het
Kdm2a A G 19: 4,345,578 Y342H probably benign Het
Kidins220 C A 12: 25,057,111 T1430K probably benign Het
Knl1 T C 2: 119,068,348 C177R possibly damaging Het
Krt32 T C 11: 100,081,203 T440A probably benign Het
Kynu T A 2: 43,679,756 F350Y probably damaging Het
Lama4 T C 10: 39,097,141 L1568P probably damaging Het
Lrp1b A T 2: 41,728,562 S281T Het
Olfr131 A T 17: 38,082,738 V80D probably damaging Het
Olfr191 A G 16: 59,086,439 S15P probably benign Het
Olfr897-ps1 C T 9: 38,309,167 T124M probably benign Het
Orc3 G A 4: 34,607,181 R50* probably null Het
Osbpl6 T A 2: 76,548,372 D124E probably damaging Het
Parp4 TG T 14: 56,595,333 probably null Het
Parp4 T C 14: 56,614,767 probably null Het
Pcdhb18 A C 18: 37,491,951 H778P probably benign Het
Polg A T 7: 79,456,112 Y710N probably benign Het
Ppp2r2b C A 18: 42,645,960 R370L possibly damaging Het
Raet1e C T 10: 22,181,973 T213I possibly damaging Het
Reln T A 5: 21,988,707 S1418C possibly damaging Het
Reln T C 5: 22,080,691 S427G probably benign Het
Rhobtb2 G A 14: 69,787,927 H633Y probably damaging Het
Serpina3i T C 12: 104,268,622 V404A probably damaging Het
Serpinb8 T C 1: 107,599,039 probably null Het
Sorl1 G T 9: 41,989,443 Q1658K probably damaging Het
Tmem26 G A 10: 68,723,986 W29* probably null Het
Togaram2 A G 17: 71,689,413 E137G probably damaging Het
Ttc39b A G 4: 83,232,786 L524S probably damaging Het
Usp43 T C 11: 67,876,519 N675S probably damaging Het
Vmn2r104 A G 17: 20,048,177 L10P possibly damaging Het
Zbtb1 G A 12: 76,385,999 R253Q probably damaging Het
Zfp354b T A 11: 50,929,429 R36S probably damaging Het
Other mutations in Chmp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1536:Chmp4c UTSW 3 10389684 missense probably benign
R1916:Chmp4c UTSW 3 10389936 missense probably benign 0.02
R5114:Chmp4c UTSW 3 10385586 missense probably benign
R5141:Chmp4c UTSW 3 10367153 missense probably damaging 0.99
R6383:Chmp4c UTSW 3 10367217 missense probably damaging 1.00
R6788:Chmp4c UTSW 3 10367135 missense possibly damaging 0.94
R7218:Chmp4c UTSW 3 10367138 missense probably damaging 1.00
R8350:Chmp4c UTSW 3 10385686 missense possibly damaging 0.61
R8450:Chmp4c UTSW 3 10385686 missense possibly damaging 0.61
R9305:Chmp4c UTSW 3 10389914 missense probably benign 0.02
R9606:Chmp4c UTSW 3 10367162 missense probably damaging 0.99
X0067:Chmp4c UTSW 3 10367063 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCTAGGTTCCCGAGACAGTAG -3'
(R):5'- TCTCCTATAATGCTACGGGCCC -3'

Sequencing Primer
(F):5'- CGAGACAGTAGGCGGGC -3'
(R):5'- ATAATGCTACGGGCCCCTTTC -3'
Posted On 2022-03-25