Incidental Mutation 'R0737:Ermap'
ID70505
Institutional Source Beutler Lab
Gene Symbol Ermap
Ensembl Gene ENSMUSG00000028644
Gene Nameerythroblast membrane-associated protein
Synonyms
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119175457-119190011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119178510 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 427 (C427F)
Ref Sequence ENSEMBL: ENSMUSP00000123426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030396] [ENSMUST00000052715] [ENSMUST00000106355] [ENSMUST00000138395] [ENSMUST00000154226] [ENSMUST00000179290]
Predicted Effect probably benign
Transcript: ENSMUST00000030396
SMART Domains Protein: ENSMUSP00000030396
Gene: ENSMUSG00000028644

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Blast:IG_like 174 260 1e-19 BLAST
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052715
SMART Domains Protein: ENSMUSP00000053013
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106355
SMART Domains Protein: ENSMUSP00000101962
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137080
Predicted Effect probably damaging
Transcript: ENSMUST00000138395
AA Change: C427F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123426
Gene: ENSMUSG00000028644
AA Change: C427F

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
coiled coil region 304 342 N/A INTRINSIC
PRY 354 406 1.15e-27 SMART
SPRY 407 532 3.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154226
Predicted Effect probably benign
Transcript: ENSMUST00000179290
SMART Domains Protein: ENSMUSP00000136119
Gene: ENSMUSG00000045268

DomainStartEndE-ValueType
ZnF_C2H2 83 105 4.54e-4 SMART
ZnF_C2H2 111 133 5.99e-4 SMART
ZnF_C2H2 139 161 3.89e-3 SMART
ZnF_C2H2 167 189 3.95e-4 SMART
ZnF_C2H2 195 217 4.72e-2 SMART
ZnF_C2H2 223 245 2.4e-3 SMART
ZnF_C2H2 251 273 1.6e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Ermap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ermap APN 4 119183917 missense probably damaging 1.00
IGL01402:Ermap APN 4 119187158 missense probably damaging 1.00
IGL02471:Ermap APN 4 119179963 missense probably damaging 0.99
IGL02696:Ermap APN 4 119187707 missense possibly damaging 0.89
IGL02806:Ermap APN 4 119188916 missense possibly damaging 0.91
R0017:Ermap UTSW 4 119179948 splice site probably benign
R0645:Ermap UTSW 4 119185691 missense probably benign 0.04
R1204:Ermap UTSW 4 119188867 missense possibly damaging 0.91
R1239:Ermap UTSW 4 119188925 missense probably benign
R1351:Ermap UTSW 4 119181361 splice site probably null
R1597:Ermap UTSW 4 119183955 missense probably damaging 1.00
R4128:Ermap UTSW 4 119187111 missense possibly damaging 0.89
R4588:Ermap UTSW 4 119188248 intron probably benign
R4853:Ermap UTSW 4 119187254 missense probably damaging 1.00
R4906:Ermap UTSW 4 119188818 intron probably benign
R4946:Ermap UTSW 4 119183308 missense probably damaging 1.00
R5187:Ermap UTSW 4 119185818 critical splice acceptor site probably null
R6275:Ermap UTSW 4 119178550 missense probably damaging 1.00
R6301:Ermap UTSW 4 119185603 missense probably damaging 1.00
R6458:Ermap UTSW 4 119178140 missense probably damaging 1.00
R6896:Ermap UTSW 4 119187131 nonsense probably null
R6997:Ermap UTSW 4 119178613 missense probably damaging 1.00
R7445:Ermap UTSW 4 119188710 missense unknown
R8193:Ermap UTSW 4 119183943 missense possibly damaging 0.87
R8711:Ermap UTSW 4 119187158 missense probably damaging 1.00
Z1177:Ermap UTSW 4 119185561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCCTCATCGTGAAGACAAGGTTC -3'
(R):5'- GCACATCCCAAACTCATCCTGTCTG -3'

Sequencing Primer
(F):5'- GACTTATCAGTCACGTTGTAGAAGG -3'
(R):5'- AAACTCATCCTGTCTGAGGATCG -3'
Posted On2013-09-30