Incidental Mutation 'R9303:Polg'
ID 705060
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Name polymerase (DNA directed), gamma
Synonyms Pol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9303 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79446231-79466362 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79456112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 710 (Y710N)
Ref Sequence ENSEMBL: ENSMUSP00000073551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000149444] [ENSMUST00000201907]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000073889
AA Change: Y710N

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: Y710N

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176
AA Change: Y176N

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176
AA Change: Y229N

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201030
Predicted Effect probably benign
Transcript: ENSMUST00000201662
Predicted Effect probably benign
Transcript: ENSMUST00000201907
SMART Domains Protein: ENSMUSP00000144084
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
Blast:POLAc 1 49 4e-24 BLAST
PDB:3IKM|D 1 50 6e-24 PDB
SCOP:d1t7pa2 21 49 3e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,500,305 C219* probably null Het
4932438A13Rik A G 3: 37,044,820 I1277V Het
Abca16 A G 7: 120,527,766 I1227V probably benign Het
Adamts17 T C 7: 66,839,897 L21P probably damaging Het
Adcy1 T C 11: 7,144,766 V564A probably damaging Het
Adgre1 A G 17: 57,441,275 N492D probably benign Het
Aldh1b1 G A 4: 45,803,811 V450M probably damaging Het
Arv1 T A 8: 124,730,946 H196Q probably damaging Het
Atp9a A T 2: 168,675,243 I390N probably benign Het
Capn10 T C 1: 92,943,943 probably null Het
Casq2 A G 3: 102,145,384 D404G unknown Het
Cenpf T C 1: 189,660,074 probably null Het
Cep295nl G A 11: 118,333,940 P26L possibly damaging Het
Chmp4c T G 3: 10,389,914 S214A probably benign Het
Chrna5 T C 9: 55,004,872 F319L probably benign Het
Csmd1 G T 8: 15,961,532 T2507K probably benign Het
Ctnnd2 T C 15: 30,966,891 M996T probably damaging Het
Dbf4 T C 5: 8,398,102 T328A unknown Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Fat1 T A 8: 45,010,461 W1347R probably damaging Het
Fbxw21 A G 9: 109,157,659 F51L probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gng2 G T 14: 19,875,893 H44N probably damaging Het
Hps5 G A 7: 46,789,195 T38I possibly damaging Het
Igf2 G A 7: 142,654,416 R64C probably damaging Het
Inpp4b C T 8: 82,033,129 A601V probably damaging Het
Kdm2a A G 19: 4,345,578 Y342H probably benign Het
Kidins220 C A 12: 25,057,111 T1430K probably benign Het
Knl1 T C 2: 119,068,348 C177R possibly damaging Het
Krt32 T C 11: 100,081,203 T440A probably benign Het
Kynu T A 2: 43,679,756 F350Y probably damaging Het
Lama4 T C 10: 39,097,141 L1568P probably damaging Het
Lrp1b A T 2: 41,728,562 S281T Het
Olfr131 A T 17: 38,082,738 V80D probably damaging Het
Olfr191 A G 16: 59,086,439 S15P probably benign Het
Olfr897-ps1 C T 9: 38,309,167 T124M probably benign Het
Orc3 G A 4: 34,607,181 R50* probably null Het
Osbpl6 T A 2: 76,548,372 D124E probably damaging Het
Parp4 TG T 14: 56,595,333 probably null Het
Parp4 T C 14: 56,614,767 probably null Het
Pcdhb18 A C 18: 37,491,951 H778P probably benign Het
Ppp2r2b C A 18: 42,645,960 R370L possibly damaging Het
Raet1e C T 10: 22,181,973 T213I possibly damaging Het
Reln T A 5: 21,988,707 S1418C possibly damaging Het
Reln T C 5: 22,080,691 S427G probably benign Het
Rhobtb2 G A 14: 69,787,927 H633Y probably damaging Het
Serpina3i T C 12: 104,268,622 V404A probably damaging Het
Serpinb8 T C 1: 107,599,039 probably null Het
Sorl1 G T 9: 41,989,443 Q1658K probably damaging Het
Tmem26 G A 10: 68,723,986 W29* probably null Het
Togaram2 A G 17: 71,689,413 E137G probably damaging Het
Ttc39b A G 4: 83,232,786 L524S probably damaging Het
Usp43 T C 11: 67,876,519 N675S probably damaging Het
Vmn2r104 A G 17: 20,048,177 L10P possibly damaging Het
Zbtb1 G A 12: 76,385,999 R253Q probably damaging Het
Zfp354b T A 11: 50,929,429 R36S probably damaging Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0416:Polg UTSW 7 79452240 unclassified probably benign
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2156:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R3720:Polg UTSW 7 79456791 nonsense probably null
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4127:Polg UTSW 7 79455537 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R4888:Polg UTSW 7 79464605 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6754:Polg UTSW 7 79459836 missense probably damaging 1.00
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
R7644:Polg UTSW 7 79451668 missense probably damaging 1.00
R7879:Polg UTSW 7 79450644 missense probably benign 0.22
R8174:Polg UTSW 7 79456718 missense probably benign 0.10
R8443:Polg UTSW 7 79464995 missense probably benign
R9176:Polg UTSW 7 79460109 missense probably benign 0.25
R9181:Polg UTSW 7 79454673 missense probably damaging 1.00
R9305:Polg UTSW 7 79456112 missense probably benign 0.02
R9323:Polg UTSW 7 79465031 frame shift probably null
R9323:Polg UTSW 7 79465038 frame shift probably null
R9331:Polg UTSW 7 79458400 missense probably damaging 1.00
Z1176:Polg UTSW 7 79453741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCCTCTATGACTGTCAATCC -3'
(R):5'- CCCCTGTGGTTCTTAACTGTAGG -3'

Sequencing Primer
(F):5'- TCCCACAAAAAGCAGTTTCCTGG -3'
(R):5'- GGAACCTGTGACCATGCTCTC -3'
Posted On 2022-03-25