Mutagenetix > Incidental Mutation

Incidental Mutation 'R0737:Cit'

70507

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

038918-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R0737 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115946919 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 836 (S836R)

Ref Sequence

ENSEMBL: ENSMUSP00000062049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051704
AA Change: S836R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: S836R

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102560
AA Change: S836R

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: S836R

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112008
AA Change: S794R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: S794R

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122877

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136780

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139881

Predicted Effect

probably damaging
Transcript: ENSMUST00000141101
AA Change: S794R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: S794R

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145363

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147479

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	T	A	X: 70,394,207		probably benign	Het
4932429P05Rik	A	G	X: 89,754,320	H586R	probably benign	Het
9130409I23Rik	G	A	1: 181,055,379	M235I	probably benign	Het
Aff4	T	A	11: 53,410,953	L1043*	probably null	Het
Ankrd11	G	T	8: 122,895,836	R426S	probably damaging	Het
Atm	T	A	9: 53,456,566	N2422I	probably damaging	Het
Bahcc1	C	A	11: 120,272,841	P655Q	probably damaging	Het
Baz2a	A	G	10: 128,116,080	I556V	possibly damaging	Het
BC017643	C	T	11: 121,227,242		probably null	Het
Ccdc33	T	C	9: 58,082,048	D114G	probably damaging	Het
Cdk5rap2	T	C	4: 70,337,375	H424R	probably benign	Het
Cfap57	T	C	4: 118,581,102	E864G	possibly damaging	Het
Clip4	C	T	17: 71,837,699	Q95*	probably null	Het
Col17a1	C	T	19: 47,669,433	G433S	possibly damaging	Het
Col6a3	A	G	1: 90,828,298	F90L	probably damaging	Het
Dnah9	T	C	11: 66,107,898	H1108R	probably damaging	Het
Elac1	A	T	18: 73,739,039	M295K	probably damaging	Het
Epas1	G	T	17: 86,829,456	G816C	possibly damaging	Het
Ermap	C	A	4: 119,178,510	C427F	probably damaging	Het
Fbxo44	T	C	4: 148,158,809		probably benign	Het
Fmo4	T	A	1: 162,808,392	K14*	probably null	Het
Gadl1	G	A	9: 116,073,987	M461I	probably damaging	Het
Garnl3	T	A	2: 32,990,642	I868F	probably damaging	Het
Gm6614	G	T	6: 142,003,428	A74E	possibly damaging	Het
Gm7168	A	G	17: 13,948,983	D204G	probably damaging	Het
Hs6st3	T	C	14: 119,869,383	F401S	possibly damaging	Het
Kcnmb1	A	T	11: 33,964,701	M1L	probably benign	Het
Krt35	T	C	11: 100,093,794	T292A	probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lamb2	T	A	9: 108,483,794	W572R	probably benign	Het
Letmd1	A	G	15: 100,469,821	T87A	probably damaging	Het
Lrp2	A	G	2: 69,448,169	Y3947H	probably damaging	Het
Mocos	T	C	18: 24,688,987	F685L	probably damaging	Het
Nsun6	A	T	2: 14,996,474	F424I	probably damaging	Het
Nup88	A	G	11: 70,969,950	M1T	probably null	Het
Olfr1209	T	C	2: 88,910,273	N40S	probably damaging	Het
Olfr1339	C	T	4: 118,735,224	R232C	probably benign	Het
Olfr297	C	T	7: 86,526,987	P77S	probably damaging	Het
Pcdhb12	T	A	18: 37,437,709	V636D	probably damaging	Het
Pclo	C	A	5: 14,515,439	A73E	probably damaging	Het
Pdlim7	A	T	13: 55,504,880		probably null	Het
Phldb1	G	A	9: 44,699,636	P67S	possibly damaging	Het
Ppp2r2b	T	C	18: 43,059,192	T17A	probably benign	Het
Rab11fip4	T	C	11: 79,683,502	V241A	probably benign	Het
Slc41a1	T	C	1: 131,840,952	L216P	probably damaging	Het
Smg6	T	A	11: 75,159,836	D1352E	probably damaging	Het
Tbc1d9	A	T	8: 83,259,313	I816F	probably damaging	Het
Tex264	T	C	9: 106,659,299	T220A	probably benign	Het
Tmco6	G	A	18: 36,741,776	V439I	probably damaging	Het
Tmem64	A	G	4: 15,266,717	I256V	probably damaging	Het
Tnks1bp1	A	G	2: 85,052,536	S236G	possibly damaging	Het
Tsc1	A	G	2: 28,670,930	T267A	possibly damaging	Het
Txndc2	A	G	17: 65,639,553		probably null	Het
Vmn2r94	G	A	17: 18,277,433	Q26*	probably null	Het
Zan	T	C	5: 137,389,249	D4900G	unknown	Het
Zkscan3	T	C	13: 21,388,596	T122A	probably benign	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACACAGGCCACTTAGTGAGAAGAC -3'
(R):5'- AGAGGGACAGTAGCTTCCCCAAAC -3'

Sequencing Primer
(F):5'- ATGACACCTGTGACGTTCAG -3'
(R):5'- CTTGAGGTATTTAAGAGTACCGGAC -3'

Posted On

2013-09-30