Mutagenetix > Incidental Mutation

Incidental Mutation 'R9303:Zbtb1'

705082

Institutional Source

Beutler Lab

Gene Symbol

Zbtb1

Ensembl Gene

ENSMUSG00000033454

Gene Name

zinc finger and BTB domain containing 1

Synonyms

C430003J21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.711) question?

Stock #

R9303 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76370266-76396950 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76385999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 253 (R253Q)

Ref Sequence

ENSEMBL: ENSMUSP00000041955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042779]

AlphaFold

Q91VL9

Predicted Effect

probably damaging
Transcript: ENSMUST00000042779
AA Change: R253Q

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000041955
Gene: ENSMUSG00000033454
AA Change: R253Q

Domain	Start	End	E-Value	Type
BTB	24	121	1.01e-16	SMART
ZnF_C2H2	216	242	2.17e1	SMART
low complexity region	359	368	N/A	INTRINSIC
ZnF_C2H2	421	443	3.38e1	SMART
ZnF_C2H2	534	554	1.4e1	SMART
ZnF_C2H2	578	600	2.02e-1	SMART
ZnF_C2H2	606	628	6.23e-2	SMART
ZnF_C2H2	634	656	1.62e0	SMART
ZnF_C2H2	662	684	1.08e-1	SMART
ZnF_C2H2	686	709	1.36e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit abnormal thymus, B cell, and T cell differentiation, and reduced numbers of T, B, and NK cells in the spleen. [provided by MGI curators]

Allele List at MGI

www.informatics.jax.org/javawi2/servlet/WIFetch

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	T	2: 85,500,305	C219*	probably null	Het
4932438A13Rik	A	G	3: 37,044,820	I1277V		Het
Abca16	A	G	7: 120,527,766	I1227V	probably benign	Het
Adamts17	T	C	7: 66,839,897	L21P	probably damaging	Het
Adcy1	T	C	11: 7,144,766	V564A	probably damaging	Het
Adgre1	A	G	17: 57,441,275	N492D	probably benign	Het
Aldh1b1	G	A	4: 45,803,811	V450M	probably damaging	Het
Arv1	T	A	8: 124,730,946	H196Q	probably damaging	Het
Atp9a	A	T	2: 168,675,243	I390N	probably benign	Het
Capn10	T	C	1: 92,943,943		probably null	Het
Casq2	A	G	3: 102,145,384	D404G	unknown	Het
Cenpf	T	C	1: 189,660,074		probably null	Het
Cep295nl	G	A	11: 118,333,940	P26L	possibly damaging	Het
Chmp4c	T	G	3: 10,389,914	S214A	probably benign	Het
Chrna5	T	C	9: 55,004,872	F319L	probably benign	Het
Csmd1	G	T	8: 15,961,532	T2507K	probably benign	Het
Ctnnd2	T	C	15: 30,966,891	M996T	probably damaging	Het
Dbf4	T	C	5: 8,398,102	T328A	unknown	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Fat1	T	A	8: 45,010,461	W1347R	probably damaging	Het
Fbxw21	A	G	9: 109,157,659	F51L	probably benign	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Gng2	G	T	14: 19,875,893	H44N	probably damaging	Het
Hps5	G	A	7: 46,789,195	T38I	possibly damaging	Het
Igf2	G	A	7: 142,654,416	R64C	probably damaging	Het
Inpp4b	C	T	8: 82,033,129	A601V	probably damaging	Het
Kdm2a	A	G	19: 4,345,578	Y342H	probably benign	Het
Kidins220	C	A	12: 25,057,111	T1430K	probably benign	Het
Knl1	T	C	2: 119,068,348	C177R	possibly damaging	Het
Krt32	T	C	11: 100,081,203	T440A	probably benign	Het
Kynu	T	A	2: 43,679,756	F350Y	probably damaging	Het
Lama4	T	C	10: 39,097,141	L1568P	probably damaging	Het
Lrp1b	A	T	2: 41,728,562	S281T		Het
Olfr131	A	T	17: 38,082,738	V80D	probably damaging	Het
Olfr191	A	G	16: 59,086,439	S15P	probably benign	Het
Olfr897-ps1	C	T	9: 38,309,167	T124M	probably benign	Het
Orc3	G	A	4: 34,607,181	R50*	probably null	Het
Osbpl6	T	A	2: 76,548,372	D124E	probably damaging	Het
Parp4	TG	T	14: 56,595,333		probably null	Het
Parp4	T	C	14: 56,614,767		probably null	Het
Pcdhb18	A	C	18: 37,491,951	H778P	probably benign	Het
Polg	A	T	7: 79,456,112	Y710N	probably benign	Het
Ppp2r2b	C	A	18: 42,645,960	R370L	possibly damaging	Het
Raet1e	C	T	10: 22,181,973	T213I	possibly damaging	Het
Reln	T	A	5: 21,988,707	S1418C	possibly damaging	Het
Reln	T	C	5: 22,080,691	S427G	probably benign	Het
Rhobtb2	G	A	14: 69,787,927	H633Y	probably damaging	Het
Serpina3i	T	C	12: 104,268,622	V404A	probably damaging	Het
Serpinb8	T	C	1: 107,599,039		probably null	Het
Sorl1	G	T	9: 41,989,443	Q1658K	probably damaging	Het
Tmem26	G	A	10: 68,723,986	W29*	probably null	Het
Togaram2	A	G	17: 71,689,413	E137G	probably damaging	Het
Ttc39b	A	G	4: 83,232,786	L524S	probably damaging	Het
Usp43	T	C	11: 67,876,519	N675S	probably damaging	Het
Vmn2r104	A	G	17: 20,048,177	L10P	possibly damaging	Het
Zfp354b	T	A	11: 50,929,429	R36S	probably damaging	Het

Other mutations in Zbtb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01891:Zbtb1	APN	12	76385661	missense	probably damaging	1.00
IGL02097:Zbtb1	APN	12	76386597	missense	probably damaging	1.00
IGL02328:Zbtb1	APN	12	76386676	missense	possibly damaging	0.75
IGL02496:Zbtb1	APN	12	76385395	missense	possibly damaging	0.76
IGL03270:Zbtb1	APN	12	76385515	missense	possibly damaging	0.59
Limited	UTSW	12	76385827	missense	probably damaging	0.99
Occasional	UTSW	12	76387010	missense	probably damaging	1.00
Old_friend	UTSW	12	76385891	missense	probably damaging	0.96
scant	UTSW	12	76385461	missense	probably damaging	1.00
R0893:Zbtb1	UTSW	12	76385339	missense	probably damaging	1.00
R1317:Zbtb1	UTSW	12	76386799	missense	probably benign	0.00
R1525:Zbtb1	UTSW	12	76386432	missense	probably benign
R1761:Zbtb1	UTSW	12	76385821	nonsense	probably null
R2920:Zbtb1	UTSW	12	76385845	missense	possibly damaging	0.83
R5307:Zbtb1	UTSW	12	76386240	missense	probably damaging	1.00
R5718:Zbtb1	UTSW	12	76386924	missense	probably benign
R5975:Zbtb1	UTSW	12	76386275	missense	possibly damaging	0.88
R6484:Zbtb1	UTSW	12	76385891	missense	probably damaging	0.96
R6493:Zbtb1	UTSW	12	76386473	missense	probably benign
R6513:Zbtb1	UTSW	12	76385830	missense	possibly damaging	0.55
R6904:Zbtb1	UTSW	12	76386211	nonsense	probably null
R6948:Zbtb1	UTSW	12	76385827	missense	probably damaging	0.99
R8725:Zbtb1	UTSW	12	76385872	missense	probably damaging	1.00
R9202:Zbtb1	UTSW	12	76387010	missense	probably damaging	1.00
R9305:Zbtb1	UTSW	12	76385999	missense	probably damaging	0.98
X0028:Zbtb1	UTSW	12	76385299	missense	probably damaging	1.00
Z1191:Zbtb1	UTSW	12	76385249	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTCTTTGCAGTTGGCCAAC -3'
(R):5'- TCTGCAGGGATATCTTCTGGC -3'

Sequencing Primer
(F):5'- TTGGCCAACTTCCCCGAG -3'
(R):5'- GGCTCCATCTTGATGATAATTCG -3'

Posted On

2022-03-25