Mutagenetix > Incidental Mutation

Incidental Mutation 'R9303:Vmn2r104'

705090

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r104

Ensembl Gene

ENSMUSG00000090315

Gene Name

vomeronasal 2, receptor 104

Synonyms

V2r7

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R9303 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20029425-20048205 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20048177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 10 (L10P)

Ref Sequence

ENSEMBL: ENSMUSP00000129895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168050]

AlphaFold

E9Q2J5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168050
AA Change: L10P

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: L10P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	85	457	4e-38	PFAM
Pfam:NCD3G	512	565	2.1e-20	PFAM
Pfam:7tm_3	598	833	1.7e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (57/57)

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	T	2: 85,500,305	C219*	probably null	Het
4932438A13Rik	A	G	3: 37,044,820	I1277V		Het
Abca16	A	G	7: 120,527,766	I1227V	probably benign	Het
Adamts17	T	C	7: 66,839,897	L21P	probably damaging	Het
Adcy1	T	C	11: 7,144,766	V564A	probably damaging	Het
Adgre1	A	G	17: 57,441,275	N492D	probably benign	Het
Aldh1b1	G	A	4: 45,803,811	V450M	probably damaging	Het
Arv1	T	A	8: 124,730,946	H196Q	probably damaging	Het
Atp9a	A	T	2: 168,675,243	I390N	probably benign	Het
Capn10	T	C	1: 92,943,943		probably null	Het
Casq2	A	G	3: 102,145,384	D404G	unknown	Het
Cenpf	T	C	1: 189,660,074		probably null	Het
Cep295nl	G	A	11: 118,333,940	P26L	possibly damaging	Het
Chmp4c	T	G	3: 10,389,914	S214A	probably benign	Het
Chrna5	T	C	9: 55,004,872	F319L	probably benign	Het
Csmd1	G	T	8: 15,961,532	T2507K	probably benign	Het
Ctnnd2	T	C	15: 30,966,891	M996T	probably damaging	Het
Dbf4	T	C	5: 8,398,102	T328A	unknown	Het
Ddc	C	T	11: 11,829,132	V331I	probably benign	Het
Fat1	T	A	8: 45,010,461	W1347R	probably damaging	Het
Fbxw21	A	G	9: 109,157,659	F51L	probably benign	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Gng2	G	T	14: 19,875,893	H44N	probably damaging	Het
Hps5	G	A	7: 46,789,195	T38I	possibly damaging	Het
Igf2	G	A	7: 142,654,416	R64C	probably damaging	Het
Inpp4b	C	T	8: 82,033,129	A601V	probably damaging	Het
Kdm2a	A	G	19: 4,345,578	Y342H	probably benign	Het
Kidins220	C	A	12: 25,057,111	T1430K	probably benign	Het
Knl1	T	C	2: 119,068,348	C177R	possibly damaging	Het
Krt32	T	C	11: 100,081,203	T440A	probably benign	Het
Kynu	T	A	2: 43,679,756	F350Y	probably damaging	Het
Lama4	T	C	10: 39,097,141	L1568P	probably damaging	Het
Lrp1b	A	T	2: 41,728,562	S281T		Het
Olfr131	A	T	17: 38,082,738	V80D	probably damaging	Het
Olfr191	A	G	16: 59,086,439	S15P	probably benign	Het
Olfr897-ps1	C	T	9: 38,309,167	T124M	probably benign	Het
Orc3	G	A	4: 34,607,181	R50*	probably null	Het
Osbpl6	T	A	2: 76,548,372	D124E	probably damaging	Het
Parp4	TG	T	14: 56,595,333		probably null	Het
Parp4	T	C	14: 56,614,767		probably null	Het
Pcdhb18	A	C	18: 37,491,951	H778P	probably benign	Het
Polg	A	T	7: 79,456,112	Y710N	probably benign	Het
Ppp2r2b	C	A	18: 42,645,960	R370L	possibly damaging	Het
Raet1e	C	T	10: 22,181,973	T213I	possibly damaging	Het
Reln	T	A	5: 21,988,707	S1418C	possibly damaging	Het
Reln	T	C	5: 22,080,691	S427G	probably benign	Het
Rhobtb2	G	A	14: 69,787,927	H633Y	probably damaging	Het
Serpina3i	T	C	12: 104,268,622	V404A	probably damaging	Het
Serpinb8	T	C	1: 107,599,039		probably null	Het
Sorl1	G	T	9: 41,989,443	Q1658K	probably damaging	Het
Tmem26	G	A	10: 68,723,986	W29*	probably null	Het
Togaram2	A	G	17: 71,689,413	E137G	probably damaging	Het
Ttc39b	A	G	4: 83,232,786	L524S	probably damaging	Het
Usp43	T	C	11: 67,876,519	N675S	probably damaging	Het
Zbtb1	G	A	12: 76,385,999	R253Q	probably damaging	Het
Zfp354b	T	A	11: 50,929,429	R36S	probably damaging	Het

Other mutations in Vmn2r104

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Vmn2r104	APN	17	20038239	missense	probably damaging	0.98
IGL01098:Vmn2r104	APN	17	20048096	missense	probably benign	0.27
IGL01333:Vmn2r104	APN	17	20042793	missense	probably benign	0.17
IGL01527:Vmn2r104	APN	17	20042896	missense	possibly damaging	0.82
IGL01773:Vmn2r104	APN	17	20040668	missense	probably benign	0.10
IGL01939:Vmn2r104	APN	17	20029925	missense	probably damaging	0.99
IGL02121:Vmn2r104	APN	17	20041794	nonsense	probably null
IGL02305:Vmn2r104	APN	17	20042856	missense	probably benign	0.09
IGL02374:Vmn2r104	APN	17	20042786	missense	probably benign	0.34
IGL03260:Vmn2r104	APN	17	20042821	missense	probably benign	0.05
IGL03366:Vmn2r104	APN	17	20029604	missense	probably damaging	1.00
R0091:Vmn2r104	UTSW	17	20041813	missense	possibly damaging	0.79
R0125:Vmn2r104	UTSW	17	20029807	missense	probably damaging	0.98
R0257:Vmn2r104	UTSW	17	20029627	missense	probably damaging	1.00
R0381:Vmn2r104	UTSW	17	20048002	nonsense	probably null
R0709:Vmn2r104	UTSW	17	20042904	missense	probably damaging	1.00
R0786:Vmn2r104	UTSW	17	20042725	missense	probably benign
R1575:Vmn2r104	UTSW	17	20042215	missense	probably damaging	1.00
R1827:Vmn2r104	UTSW	17	20042235	missense	probably damaging	0.97
R1932:Vmn2r104	UTSW	17	20040769	missense	probably damaging	1.00
R1956:Vmn2r104	UTSW	17	20042051	missense	probably damaging	0.98
R2203:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2205:Vmn2r104	UTSW	17	20029821	missense	probably benign	0.05
R2859:Vmn2r104	UTSW	17	20048193	missense	possibly damaging	0.82
R3701:Vmn2r104	UTSW	17	20029556	missense	probably damaging	1.00
R3834:Vmn2r104	UTSW	17	20029921	missense	probably benign	0.02
R4151:Vmn2r104	UTSW	17	20029885	missense	probably damaging	1.00
R4470:Vmn2r104	UTSW	17	20042241	missense	probably damaging	1.00
R4625:Vmn2r104	UTSW	17	20048181	missense	probably benign	0.00
R4754:Vmn2r104	UTSW	17	20040768	nonsense	probably null
R4911:Vmn2r104	UTSW	17	20030026	missense	probably benign	0.00
R5270:Vmn2r104	UTSW	17	20038266	missense	probably damaging	1.00
R5279:Vmn2r104	UTSW	17	20041884	missense	probably benign	0.07
R5311:Vmn2r104	UTSW	17	20029901	missense	probably damaging	1.00
R5370:Vmn2r104	UTSW	17	20030188	missense	probably damaging	0.97
R5461:Vmn2r104	UTSW	17	20030081	missense	probably damaging	1.00
R5683:Vmn2r104	UTSW	17	20040719	nonsense	probably null
R5795:Vmn2r104	UTSW	17	20030110	missense	probably benign	0.02
R5795:Vmn2r104	UTSW	17	20030282	missense	possibly damaging	0.89
R5970:Vmn2r104	UTSW	17	20029471	missense	probably benign	0.01
R5983:Vmn2r104	UTSW	17	20041708	missense	probably damaging	1.00
R5992:Vmn2r104	UTSW	17	20029485	missense	probably damaging	1.00
R6066:Vmn2r104	UTSW	17	20038311	missense	possibly damaging	0.69
R6156:Vmn2r104	UTSW	17	20041647	missense	probably damaging	1.00
R6182:Vmn2r104	UTSW	17	20030245	missense	probably benign	0.16
R6245:Vmn2r104	UTSW	17	20041567	missense	possibly damaging	0.69
R6333:Vmn2r104	UTSW	17	20029586	missense	probably benign	0.30
R6573:Vmn2r104	UTSW	17	20042225	missense	probably damaging	1.00
R7101:Vmn2r104	UTSW	17	20030096	missense	possibly damaging	0.65
R7123:Vmn2r104	UTSW	17	20040826	missense	probably benign	0.12
R7485:Vmn2r104	UTSW	17	20029475	missense	probably benign	0.01
R7514:Vmn2r104	UTSW	17	20029529	missense	probably damaging	1.00
R7634:Vmn2r104	UTSW	17	20041709	missense	possibly damaging	0.48
R7958:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8031:Vmn2r104	UTSW	17	20042786	missense	probably benign	0.34
R8094:Vmn2r104	UTSW	17	20030221	missense	possibly damaging	0.77
R8191:Vmn2r104	UTSW	17	20030203	missense	possibly damaging	0.89
R8308:Vmn2r104	UTSW	17	20040778	missense	possibly damaging	0.55
R8691:Vmn2r104	UTSW	17	20041848	missense	probably damaging	0.98
R8795:Vmn2r104	UTSW	17	20042726	missense	probably benign
R8900:Vmn2r104	UTSW	17	20041662	missense	probably damaging	0.99
R8913:Vmn2r104	UTSW	17	20029706	missense	probably damaging	1.00
R9180:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9199:Vmn2r104	UTSW	17	20041835	missense	probably damaging	0.99
R9282:Vmn2r104	UTSW	17	20040836	missense	probably damaging	1.00
R9305:Vmn2r104	UTSW	17	20048177	missense	possibly damaging	0.90
R9322:Vmn2r104	UTSW	17	20042825	missense	probably benign	0.00
R9325:Vmn2r104	UTSW	17	20048171	missense	possibly damaging	0.95
R9414:Vmn2r104	UTSW	17	20029988	missense	probably damaging	0.99
R9785:Vmn2r104	UTSW	17	20048147	missense	probably benign
RF007:Vmn2r104	UTSW	17	20048040	missense	probably benign	0.36
Z1177:Vmn2r104	UTSW	17	20029789	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACATATGGCTTAGTTGAATGTGGC -3'
(R):5'- GAATAGAGAGCCTCAGCAGC -3'

Sequencing Primer
(F):5'- GGCTTTTTCTTTTCAGTGTACAAAG -3'
(R):5'- AGCCTCAGCAGCAGTCTGAAG -3'

Posted On

2022-03-25