Incidental Mutation 'R9305:Dpysl5'
ID 705155
Institutional Source Beutler Lab
Gene Symbol Dpysl5
Ensembl Gene ENSMUSG00000029168
Gene Name dihydropyrimidinase-like 5
Synonyms CRMP-5, Crmp5, CRAM
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.234) question?
Stock # R9305 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 30868908-30956713 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30948959 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 405 (W405R)
Ref Sequence ENSEMBL: ENSMUSP00000085400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088081] [ENSMUST00000114729]
AlphaFold Q9EQF6
Predicted Effect probably damaging
Transcript: ENSMUST00000088081
AA Change: W405R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085400
Gene: ENSMUSG00000029168
AA Change: W405R

DomainStartEndE-ValueType
Pfam:Amidohydro_5 28 97 3.4e-11 PFAM
Pfam:Amidohydro_4 52 403 4.3e-17 PFAM
Pfam:Amidohydro_1 57 406 2.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114729
AA Change: W405R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110377
Gene: ENSMUSG00000029168
AA Change: W405R

DomainStartEndE-ValueType
Pfam:Amidohydro_1 57 446 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CRMP (collapsing response mediator protein) family thought to be involved in neural development. Antibodies to the encoded protein were found in some patients with neurologic symptoms who had paraneoplastic syndrome. A pseudogene of this gene is found on chromosome 11. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, abnormal Purkinje morphology, absent long term depression, and no response to BDNF. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A G 7: 120,126,989 (GRCm39) I1227V probably benign Het
Abhd8 A G 8: 71,911,148 (GRCm39) V261A possibly damaging Het
Adam34 A T 8: 44,104,416 (GRCm39) C410S probably damaging Het
Adamts17 T C 7: 66,489,645 (GRCm39) L21P probably damaging Het
Adgre1 A G 17: 57,748,275 (GRCm39) N492D probably benign Het
Aldh1b1 G A 4: 45,803,811 (GRCm39) V450M probably damaging Het
Apob A G 12: 8,058,053 (GRCm39) I2178M probably benign Het
Atp9a A T 2: 168,517,163 (GRCm39) I390N probably benign Het
Bltp1 A G 3: 37,098,969 (GRCm39) I1277V Het
Cacng2 T G 15: 77,897,542 (GRCm39) Y89S possibly damaging Het
Capn10 T C 1: 92,871,665 (GRCm39) probably null Het
Casq2 A G 3: 102,052,700 (GRCm39) D404G unknown Het
Cdh9 T A 15: 16,832,138 (GRCm39) Y342N probably damaging Het
Cenpf T C 1: 189,392,271 (GRCm39) probably null Het
Cep295nl G A 11: 118,224,766 (GRCm39) P26L possibly damaging Het
Chmp4c T G 3: 10,454,974 (GRCm39) S214A probably benign Het
Clstn2 T A 9: 97,343,537 (GRCm39) I637F probably damaging Het
Csmd1 G T 8: 16,011,532 (GRCm39) T2507K probably benign Het
Ddx55 C T 5: 124,705,012 (GRCm39) S427F probably damaging Het
Esyt1 A G 10: 128,355,388 (GRCm39) V451A possibly damaging Het
Fads2b A T 2: 85,330,649 (GRCm39) C219* probably null Het
Fam186b G A 15: 99,177,616 (GRCm39) A570V probably damaging Het
Foxa3 A G 7: 18,748,961 (GRCm39) L55P possibly damaging Het
Gng2 G T 14: 19,925,961 (GRCm39) H44N probably damaging Het
Hps5 G A 7: 46,438,619 (GRCm39) T38I possibly damaging Het
Igf2 G A 7: 142,208,153 (GRCm39) R64C probably damaging Het
Klb T A 5: 65,505,988 (GRCm39) Y78* probably null Het
Krt32 T C 11: 99,972,029 (GRCm39) T440A probably benign Het
Kynu T A 2: 43,569,768 (GRCm39) F350Y probably damaging Het
Lrp1b A T 2: 41,618,574 (GRCm39) S281T Het
Lrrc43 C T 5: 123,646,219 (GRCm39) A657V unknown Het
Mief2 C A 11: 60,622,042 (GRCm39) P204Q possibly damaging Het
Morc3 G T 16: 93,667,302 (GRCm39) R560L probably benign Het
Or2y3 A T 17: 38,393,629 (GRCm39) V80D probably damaging Het
Or8c20 A C 9: 38,260,381 (GRCm39) M1L probably benign Het
Orc3 G A 4: 34,607,181 (GRCm39) R50* probably null Het
Osbpl6 T A 2: 76,378,716 (GRCm39) D124E probably damaging Het
Parp4 TG T 14: 56,832,790 (GRCm39) probably null Het
Parp4 T C 14: 56,852,224 (GRCm39) probably null Het
Pcdhb18 A C 18: 37,625,004 (GRCm39) H778P probably benign Het
Polg A T 7: 79,105,860 (GRCm39) Y710N probably benign Het
Ppp2r2b C A 18: 42,779,025 (GRCm39) R370L possibly damaging Het
Prune2 A G 19: 17,097,625 (GRCm39) D1043G probably benign Het
Rpl6 T C 5: 121,346,516 (GRCm39) S206P possibly damaging Het
Serpina3i T C 12: 104,234,881 (GRCm39) V404A probably damaging Het
Serpinb8 T C 1: 107,526,769 (GRCm39) probably null Het
Stx11 A T 10: 12,817,564 (GRCm39) D53E probably benign Het
Thoc3 C T 13: 54,607,998 (GRCm39) W315* probably null Het
Tmem26 G A 10: 68,559,816 (GRCm39) W29* probably null Het
Togaram2 A G 17: 71,996,408 (GRCm39) E137G probably damaging Het
Ttc39b A G 4: 83,151,023 (GRCm39) L524S probably damaging Het
Usp43 T C 11: 67,767,345 (GRCm39) N675S probably damaging Het
Vmn2r104 A G 17: 20,268,439 (GRCm39) L10P possibly damaging Het
Zbtb1 G A 12: 76,432,773 (GRCm39) R253Q probably damaging Het
Zfc3h1 A G 10: 115,255,771 (GRCm39) D1474G probably benign Het
Zfp873 T C 10: 81,896,514 (GRCm39) F415S probably benign Het
Other mutations in Dpysl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02177:Dpysl5 APN 5 30,902,622 (GRCm39) missense probably damaging 1.00
IGL02277:Dpysl5 APN 5 30,946,125 (GRCm39) missense probably damaging 1.00
R0517:Dpysl5 UTSW 5 30,935,410 (GRCm39) missense probably damaging 0.99
R0788:Dpysl5 UTSW 5 30,946,185 (GRCm39) critical splice donor site probably null
R1716:Dpysl5 UTSW 5 30,935,338 (GRCm39) missense probably benign 0.00
R2016:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2208:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2211:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R2965:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R4440:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 0.99
R4863:Dpysl5 UTSW 5 30,941,687 (GRCm39) missense probably benign 0.08
R4918:Dpysl5 UTSW 5 30,949,612 (GRCm39) missense probably damaging 1.00
R5377:Dpysl5 UTSW 5 30,948,857 (GRCm39) missense probably damaging 1.00
R6379:Dpysl5 UTSW 5 30,935,317 (GRCm39) critical splice acceptor site probably null
R6621:Dpysl5 UTSW 5 30,941,813 (GRCm39) critical splice donor site probably null
R7199:Dpysl5 UTSW 5 30,940,539 (GRCm39) missense probably benign 0.21
R7232:Dpysl5 UTSW 5 30,949,642 (GRCm39) missense probably benign 0.03
R7388:Dpysl5 UTSW 5 30,902,805 (GRCm39) missense probably benign
R7446:Dpysl5 UTSW 5 30,936,231 (GRCm39) missense probably benign 0.00
R7868:Dpysl5 UTSW 5 30,902,760 (GRCm39) missense probably damaging 1.00
R8041:Dpysl5 UTSW 5 30,953,658 (GRCm39) missense probably benign 0.28
R8428:Dpysl5 UTSW 5 30,902,811 (GRCm39) missense probably damaging 0.99
R8835:Dpysl5 UTSW 5 30,936,282 (GRCm39) critical splice donor site probably null
R8888:Dpysl5 UTSW 5 30,902,687 (GRCm39) missense probably benign 0.01
R8943:Dpysl5 UTSW 5 30,935,375 (GRCm39) missense probably benign 0.33
R9033:Dpysl5 UTSW 5 30,948,941 (GRCm39) missense probably damaging 1.00
R9139:Dpysl5 UTSW 5 30,935,397 (GRCm39) missense probably benign 0.45
R9522:Dpysl5 UTSW 5 30,935,399 (GRCm39) nonsense probably null
R9700:Dpysl5 UTSW 5 30,904,417 (GRCm39) nonsense probably null
Z1176:Dpysl5 UTSW 5 30,935,464 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAAATGACCACAGCTGGGG -3'
(R):5'- GGAATGGTACCCAGAACTGTC -3'

Sequencing Primer
(F):5'- CTGGGGTAGCAAGTGCCTG -3'
(R):5'- TCTCAAATACGGTGCCACGGTAG -3'
Posted On 2022-03-25