Incidental Mutation 'R0737:Ccdc33'
ID70519
Institutional Source Beutler Lab
Gene Symbol Ccdc33
Ensembl Gene ENSMUSG00000037716
Gene Namecoiled-coil domain containing 33
SynonymsLOC382077, 4930535E21Rik
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58028677-58118823 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58082048 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 114 (D114G)
Ref Sequence ENSEMBL: ENSMUSP00000112613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042205] [ENSMUST00000098682] [ENSMUST00000119665] [ENSMUST00000128021] [ENSMUST00000136154] [ENSMUST00000215944]
Predicted Effect probably damaging
Transcript: ENSMUST00000042205
AA Change: D114G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040899
Gene: ENSMUSG00000037716
AA Change: D114G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 451 N/A INTRINSIC
coiled coil region 472 560 N/A INTRINSIC
coiled coil region 630 668 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098682
AA Change: D359G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096279
Gene: ENSMUSG00000037716
AA Change: D359G

DomainStartEndE-ValueType
C2 281 385 5.79e-3 SMART
coiled coil region 598 636 N/A INTRINSIC
coiled coil region 657 745 N/A INTRINSIC
coiled coil region 884 922 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119665
AA Change: D114G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112613
Gene: ENSMUSG00000037716
AA Change: D114G

DomainStartEndE-ValueType
C2 36 140 5.79e-3 SMART
coiled coil region 413 559 N/A INTRINSIC
coiled coil region 629 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123746
Predicted Effect probably benign
Transcript: ENSMUST00000128021
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136154
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151404
Predicted Effect possibly damaging
Transcript: ENSMUST00000215944
AA Change: D359G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Ccdc33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ccdc33 APN 9 58069974 splice site probably benign
IGL01403:Ccdc33 APN 9 58117385 missense probably damaging 1.00
IGL01411:Ccdc33 APN 9 58117636 splice site probably benign
IGL01714:Ccdc33 APN 9 58029870 missense possibly damaging 0.91
IGL02028:Ccdc33 APN 9 58076578 missense probably benign 0.13
IGL02158:Ccdc33 APN 9 58030419 missense probably damaging 0.99
IGL02174:Ccdc33 APN 9 58033655 missense probably benign 0.45
IGL02805:Ccdc33 APN 9 58098591 missense probably benign 0.43
R0276:Ccdc33 UTSW 9 58058392 missense probably damaging 0.99
R0537:Ccdc33 UTSW 9 58117454 missense probably damaging 1.00
R0789:Ccdc33 UTSW 9 58117214 splice site probably benign
R0791:Ccdc33 UTSW 9 58028763 missense possibly damaging 0.66
R0920:Ccdc33 UTSW 9 58033672 missense probably damaging 0.99
R1541:Ccdc33 UTSW 9 58117466 missense probably damaging 0.99
R1759:Ccdc33 UTSW 9 58117446 missense possibly damaging 0.84
R1857:Ccdc33 UTSW 9 58032708 missense possibly damaging 0.66
R1976:Ccdc33 UTSW 9 58117162 nonsense probably null
R1982:Ccdc33 UTSW 9 58117168 missense probably benign 0.07
R2044:Ccdc33 UTSW 9 58031112 missense possibly damaging 0.93
R2224:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2225:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2227:Ccdc33 UTSW 9 58082022 missense probably damaging 1.00
R2369:Ccdc33 UTSW 9 58076630 missense probably benign 0.44
R3899:Ccdc33 UTSW 9 58032917 missense probably damaging 0.99
R4468:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R4468:Ccdc33 UTSW 9 58069872 missense possibly damaging 0.67
R4703:Ccdc33 UTSW 9 58033670 missense possibly damaging 0.86
R4705:Ccdc33 UTSW 9 58117557 missense probably benign 0.01
R4790:Ccdc33 UTSW 9 58029957 missense probably damaging 0.96
R4817:Ccdc33 UTSW 9 58067535 missense probably damaging 0.98
R4879:Ccdc33 UTSW 9 58067556 missense possibly damaging 0.86
R4931:Ccdc33 UTSW 9 58069851 missense probably damaging 1.00
R5015:Ccdc33 UTSW 9 58118635 missense probably damaging 1.00
R5223:Ccdc33 UTSW 9 58032984 missense possibly damaging 0.91
R5327:Ccdc33 UTSW 9 58086577 missense probably benign 0.00
R5528:Ccdc33 UTSW 9 58028795 missense probably benign 0.06
R5534:Ccdc33 UTSW 9 58117167 missense possibly damaging 0.83
R5786:Ccdc33 UTSW 9 58029952 missense possibly damaging 0.93
R5844:Ccdc33 UTSW 9 58033206 splice site probably benign
R5975:Ccdc33 UTSW 9 58117478 missense possibly damaging 0.49
R6120:Ccdc33 UTSW 9 58086600 missense probably damaging 1.00
R6256:Ccdc33 UTSW 9 58101918 splice site probably null
R6363:Ccdc33 UTSW 9 58114335 missense probably benign 0.00
R6610:Ccdc33 UTSW 9 58069136 missense possibly damaging 0.66
R6767:Ccdc33 UTSW 9 58033244 missense possibly damaging 0.96
R7072:Ccdc33 UTSW 9 58111984 makesense probably null
R7121:Ccdc33 UTSW 9 58080884 missense probably benign 0.00
R7182:Ccdc33 UTSW 9 58034173 splice site probably null
R7239:Ccdc33 UTSW 9 58032909 nonsense probably null
R7655:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7656:Ccdc33 UTSW 9 58118465 missense probably damaging 0.97
R7868:Ccdc33 UTSW 9 58069091 missense probably benign
R8215:Ccdc33 UTSW 9 58032712 missense probably benign 0.18
RF003:Ccdc33 UTSW 9 58058291 missense probably benign 0.18
Z1176:Ccdc33 UTSW 9 58117416 missense probably benign 0.01
Z1177:Ccdc33 UTSW 9 58118585 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AGGCTGATGCTCAGTTGTGCCC -3'
(R):5'- AGTCTTCCTGTGCTGTATGAGCCTC -3'

Sequencing Primer
(F):5'- GGAGGAGCATCACCTAGACC -3'
(R):5'- GCTGTATGAGCCTCCCTCC -3'
Posted On2013-09-30