Mutagenetix > Incidental Mutation

Incidental Mutation 'R9306:Fbxo18'

705199

Institutional Source

Beutler Lab

Gene Symbol

Fbxo18

Ensembl Gene

ENSMUSG00000058594

Gene Name

F-box protein 18

Synonyms

Fbx18

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R9306 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

11742573-11777582 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11767576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 98 (E98G)

Ref Sequence

ENSEMBL: ENSMUSP00000071495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071564]

AlphaFold

Q8K2I9

Predicted Effect

probably benign
Transcript: ENSMUST00000071564
AA Change: E98G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: E98G

Domain	Start	End	E-Value	Type
FBOX	213	256	3.94e-3	SMART
Pfam:UvrD-helicase	626	692	8e-10	PFAM
Pfam:UvrD_C	862	935	1.7e-12	PFAM
Pfam:UvrD_C_2	867	931	1.6e-12	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam18	G	A	8: 24,646,404	S367L	possibly damaging	Het
Alox12b	A	T	11: 69,169,570	I651F	possibly damaging	Het
Arfgef2	A	G	2: 166,881,268	K1543E	probably benign	Het
Arhgap24	A	G	5: 102,846,142	I30V	possibly damaging	Het
Atad2	A	T	15: 58,096,598	Y1343*	probably null	Het
BC067074	A	G	13: 113,369,476	T2380A	unknown	Het
Clca1	A	G	3: 145,024,578	Y169H	probably damaging	Het
Eno1b	G	A	18: 48,047,855	V367I	probably benign	Het
Fbxw14	A	T	9: 109,271,212	M458K	probably benign	Het
Galnt13	A	T	2: 54,933,557	I382F	probably benign	Het
Gm12169	A	C	11: 46,528,692	M112L	probably benign	Het
Gm15922	T	A	7: 3,737,361	Q287L	probably benign	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Gm6904	T	A	14: 59,244,845	D153V	probably damaging	Het
Hoxa10	T	C	6: 52,232,655	T368A	possibly damaging	Het
Ism2	C	T	12: 87,287,052	C73Y	probably benign	Het
Kif15	T	C	9: 122,977,991	V264A	probably damaging	Het
Lars	T	C	18: 42,225,819		probably null	Het
Lmtk2	T	A	5: 144,182,781	H1353Q	probably benign	Het
Lrp1b	A	T	2: 40,628,750	C157S	possibly damaging	Het
Map3k7cl	A	G	16: 87,594,261	D91G	possibly damaging	Het
Mapk8ip1	A	T	2: 92,389,083	D134E	probably benign	Het
Meaf6	A	T	4: 125,102,973	T159S	unknown	Het
Moxd1	A	G	10: 24,252,926		probably benign	Het
Mup8	T	A	4: 60,219,682	E195V	possibly damaging	Het
Nox4	A	T	7: 87,247,573	Q48L	probably benign	Het
Olfr348	T	A	2: 36,787,395	I290N	probably damaging	Het
Olfr653	T	A	7: 104,579,921	W92R	probably damaging	Het
Olfr818	G	A	10: 129,945,420	S99F	probably damaging	Het
Otop3	G	T	11: 115,346,422	V571L	probably benign	Het
Oxr1	A	G	15: 41,823,465	H581R	possibly damaging	Het
Pappa2	A	T	1: 158,936,922	F340I	probably damaging	Het
Pcdh10	G	A	3: 45,381,369	G706D	probably benign	Het
Pdia5	A	T	16: 35,429,983	V202D	probably damaging	Het
Pdpn	G	A	4: 143,274,031	T77M	probably damaging	Het
Ptprq	T	C	10: 107,586,738	T1598A	probably benign	Het
Slc27a6	C	T	18: 58,609,881	T547I	possibly damaging	Het
Smoc1	G	A	12: 81,167,656	V282I	possibly damaging	Het
Sppl3	C	A	5: 115,074,863	N50K	probably benign	Het
Taar5	T	C	10: 23,970,883	S60P	possibly damaging	Het
Tgtp2	G	T	11: 49,059,038	Q236K	probably benign	Het
Vmn1r8	T	A	6: 57,036,728	W255R	probably benign	Het
Vmn2r11	C	T	5: 109,048,965	C547Y	probably damaging	Het
Vmn2r96	A	G	17: 18,582,964	T187A	probably benign	Het
Vwa1	G	A	4: 155,770,871	P262S	probably benign	Het

Other mutations in Fbxo18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01615:Fbxo18	APN	2	11757523	nonsense	probably null
IGL02081:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02082:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02084:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02086:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02369:Fbxo18	APN	2	11747158	missense	possibly damaging	0.61
IGL02584:Fbxo18	APN	2	11759958	missense	probably benign	0.07
IGL03138:Fbxo18	UTSW	2	11749509	intron	probably benign
R0384:Fbxo18	UTSW	2	11749578	missense	probably damaging	1.00
R0479:Fbxo18	UTSW	2	11758419	missense	probably damaging	1.00
R0972:Fbxo18	UTSW	2	11764088	splice site	probably benign
R1420:Fbxo18	UTSW	2	11767682	missense	probably benign	0.01
R1827:Fbxo18	UTSW	2	11763888	missense	possibly damaging	0.88
R1832:Fbxo18	UTSW	2	11767400	missense	probably benign	0.08
R1960:Fbxo18	UTSW	2	11757528	missense	probably damaging	0.98
R2040:Fbxo18	UTSW	2	11769895	missense	possibly damaging	0.66
R2044:Fbxo18	UTSW	2	11762970	missense	possibly damaging	0.89
R2102:Fbxo18	UTSW	2	11758289	missense	probably benign	0.18
R3236:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R3975:Fbxo18	UTSW	2	11767210	missense	possibly damaging	0.72
R4504:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4505:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4507:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4799:Fbxo18	UTSW	2	11755747	missense	probably damaging	1.00
R4894:Fbxo18	UTSW	2	11762960	missense	probably damaging	1.00
R4994:Fbxo18	UTSW	2	11764230	missense	probably damaging	1.00
R5579:Fbxo18	UTSW	2	11748993	missense	probably damaging	0.97
R5801:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R6255:Fbxo18	UTSW	2	11748446	missense	probably benign	0.31
R7011:Fbxo18	UTSW	2	11762963	missense	probably damaging	1.00
R7177:Fbxo18	UTSW	2	11755711	missense	probably damaging	1.00
R7243:Fbxo18	UTSW	2	11751525	missense	probably benign	0.11
R7331:Fbxo18	UTSW	2	11763986	missense	probably benign
R7361:Fbxo18	UTSW	2	11747076	missense	probably damaging	1.00
R7460:Fbxo18	UTSW	2	11756685	missense	probably benign	0.38
R7541:Fbxo18	UTSW	2	11749537	missense	probably benign	0.05
R8000:Fbxo18	UTSW	2	11767289	missense	probably benign	0.21
R8010:Fbxo18	UTSW	2	11767632	missense	probably benign	0.15
R8056:Fbxo18	UTSW	2	11743630	missense	probably benign	0.01
R8517:Fbxo18	UTSW	2	11777430	critical splice donor site	probably null
R8686:Fbxo18	UTSW	2	11755658	missense	probably benign	0.00
R8883:Fbxo18	UTSW	2	11749111	missense	probably benign	0.21
R9093:Fbxo18	UTSW	2	11759990	missense	probably damaging	1.00
R9342:Fbxo18	UTSW	2	11749603	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGCACTGGGACAAACTGTC -3'
(R):5'- TACTCAGGTCTTCAGTGGGTC -3'

Sequencing Primer
(F):5'- CCTAAGCCTTGAACACGATGGG -3'
(R):5'- TCTTCAGTGGGTCAGCAGC -3'

Posted On

2022-03-25