Incidental Mutation 'R9306:Fbh1'
ID 705199
Institutional Source Beutler Lab
Gene Symbol Fbh1
Ensembl Gene ENSMUSG00000058594
Gene Name F-box DNA helicase 1
Synonyms Fbx18, Fbxo18
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R9306 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 11747384-11782393 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11772387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 98 (E98G)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564]
AlphaFold Q8K2I9
Predicted Effect probably benign
Transcript: ENSMUST00000071564
AA Change: E98G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: E98G

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
Adam18 G A 8: 25,136,420 (GRCm39) S367L possibly damaging Het
Alox12b A T 11: 69,060,396 (GRCm39) I651F possibly damaging Het
Arfgef2 A G 2: 166,723,188 (GRCm39) K1543E probably benign Het
Arhgap24 A G 5: 102,994,008 (GRCm39) I30V possibly damaging Het
Atad2 A T 15: 57,959,994 (GRCm39) Y1343* probably null Het
Clca3a1 A G 3: 144,730,339 (GRCm39) Y169H probably damaging Het
Cspg4b A G 13: 113,506,010 (GRCm39) T2380A unknown Het
Eno1b G A 18: 48,180,922 (GRCm39) V367I probably benign Het
Fbxw14 A T 9: 109,100,280 (GRCm39) M458K probably benign Het
Galnt13 A T 2: 54,823,569 (GRCm39) I382F probably benign Het
Hoxa10 T C 6: 52,209,635 (GRCm39) T368A possibly damaging Het
Ism2 C T 12: 87,333,826 (GRCm39) C73Y probably benign Het
Kif15 T C 9: 122,807,056 (GRCm39) V264A probably damaging Het
Lars1 T C 18: 42,358,884 (GRCm39) probably null Het
Lmtk2 T A 5: 144,119,599 (GRCm39) H1353Q probably benign Het
Lrp1b A T 2: 40,518,762 (GRCm39) C157S possibly damaging Het
Map3k7cl A G 16: 87,391,149 (GRCm39) D91G possibly damaging Het
Mapk8ip1 A T 2: 92,219,428 (GRCm39) D134E probably benign Het
Meaf6 A T 4: 124,996,766 (GRCm39) T159S unknown Het
Moxd1 A G 10: 24,128,824 (GRCm39) probably benign Het
Mup8 T A 4: 60,219,682 (GRCm39) E195V possibly damaging Het
Nox4 A T 7: 86,896,781 (GRCm39) Q48L probably benign Het
Or1j19 T A 2: 36,677,407 (GRCm39) I290N probably damaging Het
Or52d3 T A 7: 104,229,128 (GRCm39) W92R probably damaging Het
Or6c219 G A 10: 129,781,289 (GRCm39) S99F probably damaging Het
Otop3 G T 11: 115,237,248 (GRCm39) V571L probably benign Het
Oxr1 A G 15: 41,686,861 (GRCm39) H581R possibly damaging Het
Pappa2 A T 1: 158,764,492 (GRCm39) F340I probably damaging Het
Pcdh10 G A 3: 45,335,804 (GRCm39) G706D probably benign Het
Pdia5 A T 16: 35,250,353 (GRCm39) V202D probably damaging Het
Pdpn G A 4: 143,000,601 (GRCm39) T77M probably damaging Het
Phf11 T A 14: 59,482,294 (GRCm39) D153V probably damaging Het
Pira1 T A 7: 3,740,360 (GRCm39) Q287L probably benign Het
Ptprq T C 10: 107,422,599 (GRCm39) T1598A probably benign Het
Slc27a6 C T 18: 58,742,953 (GRCm39) T547I possibly damaging Het
Smoc1 G A 12: 81,214,430 (GRCm39) V282I possibly damaging Het
Sppl3 C A 5: 115,212,922 (GRCm39) N50K probably benign Het
Taar5 T C 10: 23,846,781 (GRCm39) S60P possibly damaging Het
Tgtp2 G T 11: 48,949,865 (GRCm39) Q236K probably benign Het
Timd5 A C 11: 46,419,519 (GRCm39) M112L probably benign Het
Vmn1r8 T A 6: 57,013,713 (GRCm39) W255R probably benign Het
Vmn2r11 C T 5: 109,196,831 (GRCm39) C547Y probably damaging Het
Vmn2r96 A G 17: 18,803,226 (GRCm39) T187A probably benign Het
Vwa1 G A 4: 155,855,328 (GRCm39) P262S probably benign Het
Other mutations in Fbh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbh1 APN 2 11,762,334 (GRCm39) nonsense probably null
IGL02081:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02082:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02084:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02086:Fbh1 APN 2 11,768,938 (GRCm39) missense probably benign 0.31
IGL02369:Fbh1 APN 2 11,751,969 (GRCm39) missense possibly damaging 0.61
IGL02584:Fbh1 APN 2 11,764,769 (GRCm39) missense probably benign 0.07
IGL03138:Fbh1 UTSW 2 11,754,320 (GRCm39) intron probably benign
R0384:Fbh1 UTSW 2 11,754,389 (GRCm39) missense probably damaging 1.00
R0479:Fbh1 UTSW 2 11,763,230 (GRCm39) missense probably damaging 1.00
R0972:Fbh1 UTSW 2 11,768,899 (GRCm39) splice site probably benign
R1420:Fbh1 UTSW 2 11,772,493 (GRCm39) missense probably benign 0.01
R1827:Fbh1 UTSW 2 11,768,699 (GRCm39) missense possibly damaging 0.88
R1832:Fbh1 UTSW 2 11,772,211 (GRCm39) missense probably benign 0.08
R1960:Fbh1 UTSW 2 11,762,339 (GRCm39) missense probably damaging 0.98
R2040:Fbh1 UTSW 2 11,774,706 (GRCm39) missense possibly damaging 0.66
R2044:Fbh1 UTSW 2 11,767,781 (GRCm39) missense possibly damaging 0.89
R2102:Fbh1 UTSW 2 11,763,100 (GRCm39) missense probably benign 0.18
R3236:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R3975:Fbh1 UTSW 2 11,772,021 (GRCm39) missense possibly damaging 0.72
R4504:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4505:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4507:Fbh1 UTSW 2 11,753,828 (GRCm39) missense possibly damaging 0.91
R4799:Fbh1 UTSW 2 11,760,558 (GRCm39) missense probably damaging 1.00
R4894:Fbh1 UTSW 2 11,767,771 (GRCm39) missense probably damaging 1.00
R4994:Fbh1 UTSW 2 11,769,041 (GRCm39) missense probably damaging 1.00
R5579:Fbh1 UTSW 2 11,753,804 (GRCm39) missense probably damaging 0.97
R5801:Fbh1 UTSW 2 11,774,637 (GRCm39) missense probably damaging 1.00
R6255:Fbh1 UTSW 2 11,753,257 (GRCm39) missense probably benign 0.31
R7011:Fbh1 UTSW 2 11,767,774 (GRCm39) missense probably damaging 1.00
R7177:Fbh1 UTSW 2 11,760,522 (GRCm39) missense probably damaging 1.00
R7243:Fbh1 UTSW 2 11,756,336 (GRCm39) missense probably benign 0.11
R7331:Fbh1 UTSW 2 11,768,797 (GRCm39) missense probably benign
R7361:Fbh1 UTSW 2 11,751,887 (GRCm39) missense probably damaging 1.00
R7460:Fbh1 UTSW 2 11,761,496 (GRCm39) missense probably benign 0.38
R7541:Fbh1 UTSW 2 11,754,348 (GRCm39) missense probably benign 0.05
R8000:Fbh1 UTSW 2 11,772,100 (GRCm39) missense probably benign 0.21
R8010:Fbh1 UTSW 2 11,772,443 (GRCm39) missense probably benign 0.15
R8056:Fbh1 UTSW 2 11,748,441 (GRCm39) missense probably benign 0.01
R8517:Fbh1 UTSW 2 11,782,241 (GRCm39) critical splice donor site probably null
R8686:Fbh1 UTSW 2 11,760,469 (GRCm39) missense probably benign 0.00
R8883:Fbh1 UTSW 2 11,753,922 (GRCm39) missense probably benign 0.21
R9093:Fbh1 UTSW 2 11,764,801 (GRCm39) missense probably damaging 1.00
R9342:Fbh1 UTSW 2 11,754,414 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCACTGGGACAAACTGTC -3'
(R):5'- TACTCAGGTCTTCAGTGGGTC -3'

Sequencing Primer
(F):5'- CCTAAGCCTTGAACACGATGGG -3'
(R):5'- TCTTCAGTGGGTCAGCAGC -3'
Posted On 2022-03-25