Mutagenetix > Incidental Mutation

Incidental Mutation 'R0737:Gadl1'

70522

Institutional Source

Beutler Lab

Gene Symbol

Gadl1

Ensembl Gene

ENSMUSG00000056880

Gene Name

glutamate decarboxylase-like 1

Synonyms

MMRRC Submission

038918-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R0737 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115909455-116076176 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 116073987 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 461 (M461I)

Ref Sequence

ENSEMBL: ENSMUSP00000113240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069651] [ENSMUST00000121770]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069651
AA Change: M461I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000077694
Gene: ENSMUSG00000056880
AA Change: M461I

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	58	426	1.1e-113	PFAM
Pfam:Beta_elim_lyase	137	467	1e-7	PFAM
Pfam:Aminotran_5	167	333	1.6e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121770
AA Change: M461I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113240
Gene: ENSMUSG00000056880
AA Change: M461I

Domain	Start	End	E-Value	Type
Pfam:Pyridoxal_deC	58	426	2.8e-112	PFAM
Pfam:Beta_elim_lyase	137	461	6.2e-8	PFAM
Pfam:Aminotran_5	184	330	4.1e-7	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 94.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	T	A	X: 70,394,207		probably benign	Het
4932429P05Rik	A	G	X: 89,754,320	H586R	probably benign	Het
9130409I23Rik	G	A	1: 181,055,379	M235I	probably benign	Het
Aff4	T	A	11: 53,410,953	L1043*	probably null	Het
Ankrd11	G	T	8: 122,895,836	R426S	probably damaging	Het
Atm	T	A	9: 53,456,566	N2422I	probably damaging	Het
Bahcc1	C	A	11: 120,272,841	P655Q	probably damaging	Het
Baz2a	A	G	10: 128,116,080	I556V	possibly damaging	Het
BC017643	C	T	11: 121,227,242		probably null	Het
Ccdc33	T	C	9: 58,082,048	D114G	probably damaging	Het
Cdk5rap2	T	C	4: 70,337,375	H424R	probably benign	Het
Cfap57	T	C	4: 118,581,102	E864G	possibly damaging	Het
Cit	T	A	5: 115,946,919	S836R	probably damaging	Het
Clip4	C	T	17: 71,837,699	Q95*	probably null	Het
Col17a1	C	T	19: 47,669,433	G433S	possibly damaging	Het
Col6a3	A	G	1: 90,828,298	F90L	probably damaging	Het
Dnah9	T	C	11: 66,107,898	H1108R	probably damaging	Het
Elac1	A	T	18: 73,739,039	M295K	probably damaging	Het
Epas1	G	T	17: 86,829,456	G816C	possibly damaging	Het
Ermap	C	A	4: 119,178,510	C427F	probably damaging	Het
Fbxo44	T	C	4: 148,158,809		probably benign	Het
Fmo4	T	A	1: 162,808,392	K14*	probably null	Het
Garnl3	T	A	2: 32,990,642	I868F	probably damaging	Het
Gm6614	G	T	6: 142,003,428	A74E	possibly damaging	Het
Gm7168	A	G	17: 13,948,983	D204G	probably damaging	Het
Hs6st3	T	C	14: 119,869,383	F401S	possibly damaging	Het
Kcnmb1	A	T	11: 33,964,701	M1L	probably benign	Het
Krt35	T	C	11: 100,093,794	T292A	probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lamb2	T	A	9: 108,483,794	W572R	probably benign	Het
Letmd1	A	G	15: 100,469,821	T87A	probably damaging	Het
Lrp2	A	G	2: 69,448,169	Y3947H	probably damaging	Het
Mocos	T	C	18: 24,688,987	F685L	probably damaging	Het
Nsun6	A	T	2: 14,996,474	F424I	probably damaging	Het
Nup88	A	G	11: 70,969,950	M1T	probably null	Het
Olfr1209	T	C	2: 88,910,273	N40S	probably damaging	Het
Olfr1339	C	T	4: 118,735,224	R232C	probably benign	Het
Olfr297	C	T	7: 86,526,987	P77S	probably damaging	Het
Pcdhb12	T	A	18: 37,437,709	V636D	probably damaging	Het
Pclo	C	A	5: 14,515,439	A73E	probably damaging	Het
Pdlim7	A	T	13: 55,504,880		probably null	Het
Phldb1	G	A	9: 44,699,636	P67S	possibly damaging	Het
Ppp2r2b	T	C	18: 43,059,192	T17A	probably benign	Het
Rab11fip4	T	C	11: 79,683,502	V241A	probably benign	Het
Slc41a1	T	C	1: 131,840,952	L216P	probably damaging	Het
Smg6	T	A	11: 75,159,836	D1352E	probably damaging	Het
Tbc1d9	A	T	8: 83,259,313	I816F	probably damaging	Het
Tex264	T	C	9: 106,659,299	T220A	probably benign	Het
Tmco6	G	A	18: 36,741,776	V439I	probably damaging	Het
Tmem64	A	G	4: 15,266,717	I256V	probably damaging	Het
Tnks1bp1	A	G	2: 85,052,536	S236G	possibly damaging	Het
Tsc1	A	G	2: 28,670,930	T267A	possibly damaging	Het
Txndc2	A	G	17: 65,639,553		probably null	Het
Vmn2r94	G	A	17: 18,277,433	Q26*	probably null	Het
Zan	T	C	5: 137,389,249	D4900G	unknown	Het
Zkscan3	T	C	13: 21,388,596	T122A	probably benign	Het

Other mutations in Gadl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01069:Gadl1	APN	9	115954839	critical splice donor site	probably null
IGL01343:Gadl1	APN	9	116074112	makesense	probably null
IGL01693:Gadl1	APN	9	115949585	missense	probably damaging	1.00
IGL02106:Gadl1	APN	9	115937157	utr 5 prime	probably benign
IGL02740:Gadl1	APN	9	116006561	nonsense	probably null
IGL03063:Gadl1	APN	9	115966267	missense	probably damaging	1.00
IGL03104:Gadl1	APN	9	116074040	missense	possibly damaging	0.93
IGL03127:Gadl1	APN	9	115948664	missense	probably damaging	1.00
R0133:Gadl1	UTSW	9	115941343	missense	probably benign	0.00
R0285:Gadl1	UTSW	9	116030738	splice site	probably benign
R0771:Gadl1	UTSW	9	115944232	missense	probably damaging	1.00
R1522:Gadl1	UTSW	9	115944229	missense	probably damaging	1.00
R1716:Gadl1	UTSW	9	116006508	nonsense	probably null
R2061:Gadl1	UTSW	9	115941380	missense	probably damaging	1.00
R2163:Gadl1	UTSW	9	115949558	missense	possibly damaging	0.93
R3854:Gadl1	UTSW	9	116006664	nonsense	probably null
R3964:Gadl1	UTSW	9	115965608	missense	probably damaging	0.98
R4654:Gadl1	UTSW	9	115941340	missense	probably damaging	1.00
R4724:Gadl1	UTSW	9	115954617	missense	possibly damaging	0.81
R4765:Gadl1	UTSW	9	115966313	missense	probably null	0.00
R4956:Gadl1	UTSW	9	116040919	missense	probably benign	0.00
R5179:Gadl1	UTSW	9	115960380	nonsense	probably null
R5593:Gadl1	UTSW	9	116006650	missense	probably damaging	1.00
R5620:Gadl1	UTSW	9	115937162	start codon destroyed	probably benign	0.09
R6048:Gadl1	UTSW	9	116006701	splice site	probably null
R6458:Gadl1	UTSW	9	116041002	makesense	probably null
R7497:Gadl1	UTSW	9	116074087	missense	probably benign	0.00
R7889:Gadl1	UTSW	9	115954815	missense	possibly damaging	0.56
R8843:Gadl1	UTSW	9	116006501	missense	probably benign	0.00
R8858:Gadl1	UTSW	9	116006601	missense	probably damaging	1.00
R9015:Gadl1	UTSW	9	115965637	missense	probably benign	0.03
R9459:Gadl1	UTSW	9	115965611	missense	probably damaging	1.00
R9758:Gadl1	UTSW	9	115960451	missense	probably benign	0.09
Z1088:Gadl1	UTSW	9	115937270	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAAGATTCTCCTGAGCCTGACCC -3'
(R):5'- CTTCAGACGCACTGGATCTGTGAC -3'

Sequencing Primer
(F):5'- ATCTGCCAGTGGATGCTGC -3'
(R):5'- GATCTGTGACCCTCCCCAG -3'

Posted On

2013-09-30