Incidental Mutation 'R9307:Dpyd'
ID 705256
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9307 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119314911 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 868 (V868I)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably benign
Transcript: ENSMUST00000039177
AA Change: V868I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: V868I

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,422 D124A probably benign Het
2310035C23Rik A T 1: 105,687,352 Y272F probably benign Het
Acd T C 8: 105,698,882 D273G probably damaging Het
Adam15 T C 3: 89,347,483 D90G possibly damaging Het
Adam2 A T 14: 66,050,472 C392S probably damaging Het
Adam23 T A 1: 63,536,972 N304K probably damaging Het
Aldh3b3 T C 19: 3,963,882 F28L probably damaging Het
BC080695 C A 4: 143,572,744 L326I probably damaging Het
Bsn A G 9: 108,115,794 S920P probably benign Het
Btc A G 5: 91,402,656 probably null Het
Chchd2 A T 5: 129,887,213 V12E probably benign Het
Chil4 A T 3: 106,204,066 probably null Het
Clock A G 5: 76,216,824 F815L unknown Het
Cmtr2 C T 8: 110,223,080 T674M probably benign Het
Cnbd1 A C 4: 18,887,647 I289R probably damaging Het
Cog2 A T 8: 124,527,098 probably null Het
Col13a1 T C 10: 61,867,469 I454V unknown Het
Cyct T A 2: 76,354,113 Y98F probably benign Het
Dcaf6 T C 1: 165,399,667 E297G possibly damaging Het
Dgka T C 10: 128,731,177 H271R probably damaging Het
Dnah9 T A 11: 66,085,474 I1250F probably benign Het
Dock4 T C 12: 40,636,156 L130P probably damaging Het
Dync1li1 T A 9: 114,706,008 D113E probably damaging Het
Fat3 T C 9: 16,021,423 K1405E probably damaging Het
Fbn2 A G 18: 58,209,784 C8R probably benign Het
Frmd4a A G 2: 4,604,233 M971V probably benign Het
Glyatl3 C T 17: 40,912,662 probably null Het
Gm498 G T 7: 143,881,165 probably null Het
Gm5346 A C 8: 43,626,267 F307V probably benign Het
Grip1 A T 10: 119,985,549 H373L probably benign Het
Ins1 T C 19: 52,264,820 L66P possibly damaging Het
Kif21b A T 1: 136,174,062 I1616L probably benign Het
Map7d1 A G 4: 126,234,231 M637T unknown Het
Mc2r A T 18: 68,407,565 M219K probably benign Het
Mcpt1 A G 14: 56,019,410 D135G possibly damaging Het
Mturn T C 6: 54,699,556 probably null Het
Mutyh T A 4: 116,816,877 probably null Het
Myh3 A G 11: 67,093,571 D1078G possibly damaging Het
Olfr984 T C 9: 40,101,155 I112V probably benign Het
Pcdha12 A G 18: 37,020,821 K198E probably damaging Het
Pcf11 A T 7: 92,657,326 N1211K possibly damaging Het
Piezo1 G A 8: 122,487,093 P1711S Het
Pkd1 T A 17: 24,550,477 L72Q possibly damaging Het
Prss12 A G 3: 123,505,400 D607G probably benign Het
R3hdml T C 2: 163,502,452 *254R probably null Het
Rasal3 TTGGACCTGAGTGGA TTGGA 17: 32,393,528 probably null Het
Rev3l C T 10: 39,817,153 P410S probably benign Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Sec14l2 A G 11: 4,118,665 V5A probably benign Het
Slc12a3 A C 8: 94,334,997 I291L probably benign Het
Slc4a10 T C 2: 62,253,318 F372L probably damaging Het
Spta1 T C 1: 174,208,412 W1095R probably damaging Het
Synj1 T C 16: 90,988,207 T254A probably damaging Het
Taar2 T C 10: 23,941,339 F259S probably damaging Het
Tcrg-V3 A G 13: 19,243,271 E108G probably damaging Het
Tns2 C A 15: 102,110,561 L396I probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,649,822 probably benign Het
Traf5 T C 1: 192,062,733 D96G probably damaging Het
Trpv6 A G 6: 41,625,444 V336A probably benign Het
Usp45 A T 4: 21,824,998 L583F probably damaging Het
Utrn T C 10: 12,678,731 D1538G probably benign Het
Vmn1r209 T A 13: 22,805,902 H206L probably damaging Het
Zfp51 T A 17: 21,464,471 H449Q probably benign Het
Zfp653 G A 9: 22,058,025 S315F possibly damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCCTAGGTATGCAGCGC -3'
(R):5'- AGAGGCACTTCACATTGCC -3'

Sequencing Primer
(F):5'- GGTATGCAGCGCTATTCAGAATC -3'
(R):5'- AGCTGTAATCAAGCCTGCTTCAG -3'
Posted On 2022-03-25