Incidental Mutation 'R9307:1110002E22Rik'
ID 705258
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene Name RIKEN cDNA 1110002E22 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.680) question?
Stock # R9307 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 138065052-138081506 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 138065422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 124 (D124A)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053318
Predicted Effect probably benign
Transcript: ENSMUST00000163080
AA Change: D124A

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: D124A

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,687,352 Y272F probably benign Het
Acd T C 8: 105,698,882 D273G probably damaging Het
Adam15 T C 3: 89,347,483 D90G possibly damaging Het
Adam2 A T 14: 66,050,472 C392S probably damaging Het
Adam23 T A 1: 63,536,972 N304K probably damaging Het
Aldh3b3 T C 19: 3,963,882 F28L probably damaging Het
BC080695 C A 4: 143,572,744 L326I probably damaging Het
Bsn A G 9: 108,115,794 S920P probably benign Het
Btc A G 5: 91,402,656 probably null Het
Chchd2 A T 5: 129,887,213 V12E probably benign Het
Chil4 A T 3: 106,204,066 probably null Het
Clock A G 5: 76,216,824 F815L unknown Het
Cmtr2 C T 8: 110,223,080 T674M probably benign Het
Cnbd1 A C 4: 18,887,647 I289R probably damaging Het
Cog2 A T 8: 124,527,098 probably null Het
Col13a1 T C 10: 61,867,469 I454V unknown Het
Cyct T A 2: 76,354,113 Y98F probably benign Het
Dcaf6 T C 1: 165,399,667 E297G possibly damaging Het
Dgka T C 10: 128,731,177 H271R probably damaging Het
Dnah9 T A 11: 66,085,474 I1250F probably benign Het
Dock4 T C 12: 40,636,156 L130P probably damaging Het
Dpyd G A 3: 119,314,911 V868I probably benign Het
Dync1li1 T A 9: 114,706,008 D113E probably damaging Het
Fat3 T C 9: 16,021,423 K1405E probably damaging Het
Fbn2 A G 18: 58,209,784 C8R probably benign Het
Frmd4a A G 2: 4,604,233 M971V probably benign Het
Glyatl3 C T 17: 40,912,662 probably null Het
Gm498 G T 7: 143,881,165 probably null Het
Gm5346 A C 8: 43,626,267 F307V probably benign Het
Grip1 A T 10: 119,985,549 H373L probably benign Het
Ins1 T C 19: 52,264,820 L66P possibly damaging Het
Kif21b A T 1: 136,174,062 I1616L probably benign Het
Map7d1 A G 4: 126,234,231 M637T unknown Het
Mc2r A T 18: 68,407,565 M219K probably benign Het
Mcpt1 A G 14: 56,019,410 D135G possibly damaging Het
Mturn T C 6: 54,699,556 probably null Het
Mutyh T A 4: 116,816,877 probably null Het
Myh3 A G 11: 67,093,571 D1078G possibly damaging Het
Olfr984 T C 9: 40,101,155 I112V probably benign Het
Pcdha12 A G 18: 37,020,821 K198E probably damaging Het
Pcf11 A T 7: 92,657,326 N1211K possibly damaging Het
Piezo1 G A 8: 122,487,093 P1711S Het
Pkd1 T A 17: 24,550,477 L72Q possibly damaging Het
Prss12 A G 3: 123,505,400 D607G probably benign Het
R3hdml T C 2: 163,502,452 *254R probably null Het
Rasal3 TTGGACCTGAGTGGA TTGGA 17: 32,393,528 probably null Het
Rev3l C T 10: 39,817,153 P410S probably benign Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Sec14l2 A G 11: 4,118,665 V5A probably benign Het
Slc12a3 A C 8: 94,334,997 I291L probably benign Het
Slc4a10 T C 2: 62,253,318 F372L probably damaging Het
Spta1 T C 1: 174,208,412 W1095R probably damaging Het
Synj1 T C 16: 90,988,207 T254A probably damaging Het
Taar2 T C 10: 23,941,339 F259S probably damaging Het
Tcrg-V3 A G 13: 19,243,271 E108G probably damaging Het
Tns2 C A 15: 102,110,561 L396I probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,649,822 probably benign Het
Traf5 T C 1: 192,062,733 D96G probably damaging Het
Trpv6 A G 6: 41,625,444 V336A probably benign Het
Usp45 A T 4: 21,824,998 L583F probably damaging Het
Utrn T C 10: 12,678,731 D1538G probably benign Het
Vmn1r209 T A 13: 22,805,902 H206L probably damaging Het
Zfp51 T A 17: 21,464,471 H449Q probably benign Het
Zfp653 G A 9: 22,058,025 S315F possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion probably benign
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1023:1110002E22Rik UTSW 3 138066871 missense probably damaging 1.00
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense probably benign 0.02
R6305:1110002E22Rik UTSW 3 138067980 missense probably damaging 1.00
R6457:1110002E22Rik UTSW 3 138066622 missense probably damaging 1.00
R6469:1110002E22Rik UTSW 3 138066975 missense probably damaging 0.97
R6499:1110002E22Rik UTSW 3 138068800 missense probably damaging 1.00
R6527:1110002E22Rik UTSW 3 138067527 missense probably damaging 0.99
R6580:1110002E22Rik UTSW 3 138066625 missense probably benign 0.00
R6693:1110002E22Rik UTSW 3 138069154 missense probably benign 0.00
R6751:1110002E22Rik UTSW 3 138066210 missense probably damaging 1.00
R6852:1110002E22Rik UTSW 3 138065169 nonsense probably null
R6920:1110002E22Rik UTSW 3 138068050 missense probably damaging 1.00
R7001:1110002E22Rik UTSW 3 138065511 missense probably benign
R7145:1110002E22Rik UTSW 3 138070059 missense probably damaging 1.00
R7238:1110002E22Rik UTSW 3 138069951 missense probably damaging 1.00
R7278:1110002E22Rik UTSW 3 138065476 missense probably benign
R7425:1110002E22Rik UTSW 3 138065695 missense probably benign 0.00
R7487:1110002E22Rik UTSW 3 138066868 missense probably damaging 1.00
R7557:1110002E22Rik UTSW 3 138068283 nonsense probably null
R7663:1110002E22Rik UTSW 3 138066126 missense probably damaging 0.98
R7743:1110002E22Rik UTSW 3 138068755 missense probably damaging 1.00
R7799:1110002E22Rik UTSW 3 138069601 missense probably benign 0.33
R8181:1110002E22Rik UTSW 3 138068395 missense probably damaging 0.99
R8264:1110002E22Rik UTSW 3 138067782 missense probably damaging 0.99
R8273:1110002E22Rik UTSW 3 138066450 missense probably benign
R8434:1110002E22Rik UTSW 3 138067260 missense probably damaging 0.97
R8530:1110002E22Rik UTSW 3 138068825 missense probably damaging 0.99
R8754:1110002E22Rik UTSW 3 138066037 missense probably benign
R8808:1110002E22Rik UTSW 3 138070113 missense probably benign 0.01
R8891:1110002E22Rik UTSW 3 138066759 nonsense probably null
R9026:1110002E22Rik UTSW 3 138065148 missense possibly damaging 0.53
R9177:1110002E22Rik UTSW 3 138069916 missense probably damaging 1.00
R9250:1110002E22Rik UTSW 3 138066628 missense probably damaging 1.00
R9291:1110002E22Rik UTSW 3 138066703 missense probably benign 0.02
R9293:1110002E22Rik UTSW 3 138066078 missense possibly damaging 0.93
R9439:1110002E22Rik UTSW 3 138066287 missense probably benign 0.00
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGGACTGGACAGCTCAG -3'
(R):5'- ACGTCTCCACATACTTGGC -3'

Sequencing Primer
(F):5'- TCAGCAGCAGGACACTGG -3'
(R):5'- CCACATACTTGGCTTCAGGC -3'
Posted On 2022-03-25