Mutagenetix > Incidental Mutation

Incidental Mutation 'R9307:Cog2'

705276

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9307 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to T at 124527098 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]

AlphaFold

Q921L5

Predicted Effect

probably null
Transcript: ENSMUST00000034460

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176159

SMART Domains

Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176279

SMART Domains

Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	101	1.5e-37	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 97.8%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	C	3: 138,065,422	D124A	probably benign	Het
2310035C23Rik	A	T	1: 105,687,352	Y272F	probably benign	Het
Acd	T	C	8: 105,698,882	D273G	probably damaging	Het
Adam15	T	C	3: 89,347,483	D90G	possibly damaging	Het
Adam2	A	T	14: 66,050,472	C392S	probably damaging	Het
Adam23	T	A	1: 63,536,972	N304K	probably damaging	Het
Aldh3b3	T	C	19: 3,963,882	F28L	probably damaging	Het
BC080695	C	A	4: 143,572,744	L326I	probably damaging	Het
Bsn	A	G	9: 108,115,794	S920P	probably benign	Het
Btc	A	G	5: 91,402,656		probably null	Het
Chchd2	A	T	5: 129,887,213	V12E	probably benign	Het
Chia1	A	G	3: 106,128,675		probably benign	Het
Chil4	A	T	3: 106,204,066		probably null	Het
Clock	A	G	5: 76,216,824	F815L	unknown	Het
Cmtr2	C	T	8: 110,223,080	T674M	probably benign	Het
Cnbd1	A	C	4: 18,887,647	I289R	probably damaging	Het
Col13a1	T	C	10: 61,867,469	I454V	unknown	Het
Cyct	T	A	2: 76,354,113	Y98F	probably benign	Het
Dcaf6	T	C	1: 165,399,667	E297G	possibly damaging	Het
Dgka	T	C	10: 128,731,177	H271R	probably damaging	Het
Dnah9	T	A	11: 66,085,474	I1250F	probably benign	Het
Dock4	T	C	12: 40,636,156	L130P	probably damaging	Het
Dpyd	G	A	3: 119,314,911	V868I	probably benign	Het
Dync1li1	T	A	9: 114,706,008	D113E	probably damaging	Het
Fat3	T	C	9: 16,021,423	K1405E	probably damaging	Het
Fbn2	A	G	18: 58,209,784	C8R	probably benign	Het
Frmd4a	A	G	2: 4,604,233	M971V	probably benign	Het
Glyatl3	C	T	17: 40,912,662		probably null	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Gm5346	A	C	8: 43,626,267	F307V	probably benign	Het
Grip1	A	T	10: 119,985,549	H373L	probably benign	Het
Ins1	T	C	19: 52,264,820	L66P	possibly damaging	Het
Kif21b	A	T	1: 136,174,062	I1616L	probably benign	Het
Map7d1	A	G	4: 126,234,231	M637T	unknown	Het
Mc2r	A	T	18: 68,407,565	M219K	probably benign	Het
Mcpt1	A	G	14: 56,019,410	D135G	possibly damaging	Het
Mturn	T	C	6: 54,699,556		probably null	Het
Mutyh	T	A	4: 116,816,877		probably null	Het
Myh3	A	G	11: 67,093,571	D1078G	possibly damaging	Het
Olfr984	T	C	9: 40,101,155	I112V	probably benign	Het
Pcdha12	A	G	18: 37,020,821	K198E	probably damaging	Het
Pcf11	A	T	7: 92,657,326	N1211K	possibly damaging	Het
Piezo1	G	A	8: 122,487,093	P1711S		Het
Pkd1	T	A	17: 24,550,477	L72Q	possibly damaging	Het
Prss12	A	G	3: 123,505,400	D607G	probably benign	Het
R3hdml	T	C	2: 163,502,452	*254R	probably null	Het
Rasal3	TTGGACCTGAGTGGA	TTGGA	17: 32,393,528	782	probably null	Het
Rev3l	C	T	10: 39,817,153	P410S	probably benign	Het
Sec14l2	A	G	11: 4,118,665	V5A	probably benign	Het
Slc12a3	A	C	8: 94,334,997	I291L	probably benign	Het
Slc4a10	T	C	2: 62,253,318	F372L	probably damaging	Het
Spta1	T	C	1: 174,208,412	W1095R	probably damaging	Het
Synj1	T	C	16: 90,988,207	T254A	probably damaging	Het
Taar2	T	C	10: 23,941,339	F259S	probably damaging	Het
Tcrg-V3	A	G	13: 19,243,271	E108G	probably damaging	Het
Tns2	C	A	15: 102,110,561	L396I	probably damaging	Het
Tom1l1	TTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTG	11: 90,649,822		probably benign	Het
Traf5	T	C	1: 192,062,733	D96G	probably damaging	Het
Trpv6	A	G	6: 41,625,444	V336A	probably benign	Het
Usp45	A	T	4: 21,824,998	L583F	probably damaging	Het
Utrn	T	C	10: 12,678,731	D1538G	probably benign	Het
Vmn1r209	T	A	13: 22,805,902	H206L	probably damaging	Het
Zfp51	T	A	17: 21,464,471	H449Q	probably benign	Het
Zfp653	G	A	9: 22,058,025	S315F	possibly damaging	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AGCACTTGTCCTCAGCTCAC -3'
(R):5'- ACGGCAGTATCACATGCTAAACAG -3'

Sequencing Primer
(F):5'- TGTCCTCAGCTCACCCCAAATC -3'
(R):5'- CAGTTATCTGCAATGTCTGAGATG -3'

Posted On

2022-03-25