Mutagenetix > Incidental Mutation

Incidental Mutation 'R0737:Smg6'

70528

Institutional Source

Beutler Lab

Gene Symbol

Smg6

Ensembl Gene

ENSMUSG00000038290

Gene Name

Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)

Synonyms

MMRRC Submission

038918-MU

Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0737 (G1)

Quality Score

223

Status

Not validated

Chromosome

Chromosomal Location

74925823-75164448 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75159836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1352 (D1352E)

Ref Sequence

ENSEMBL: ENSMUSP00000043555 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]

AlphaFold

P61406

Predicted Effect

probably damaging
Transcript: ENSMUST00000045281
AA Change: D1352E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290
AA Change: D1352E

Domain	Start	End	E-Value	Type
internal_repeat_1	42	99	7.68e-6	PROSPERO
internal_repeat_1	135	188	7.68e-6	PROSPERO
low complexity region	212	227	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
low complexity region	376	390	N/A	INTRINSIC
low complexity region	417	426	N/A	INTRINSIC
low complexity region	436	453	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
coiled coil region	574	600	N/A	INTRINSIC
Pfam:EST1	637	742	1.8e-18	PFAM
Pfam:EST1_DNA_bind	750	1106	1.6e-78	PFAM
coiled coil region	1197	1234	N/A	INTRINSIC
PINc	1245	1396	2.85e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000055619

SMART Domains

Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	192	200	N/A	INTRINSIC
BTB	207	313	6.94e-24	SMART
low complexity region	318	340	N/A	INTRINSIC
low complexity region	350	370	N/A	INTRINSIC
Blast:BTB	375	398	1e-7	BLAST
low complexity region	415	437	N/A	INTRINSIC
low complexity region	442	453	N/A	INTRINSIC
low complexity region	464	486	N/A	INTRINSIC
low complexity region	519	542	N/A	INTRINSIC
ZnF_C2H2	597	619	1.08e-1	SMART
ZnF_C2H2	667	689	1.18e-2	SMART
ZnF_C2H2	695	717	9.36e-6	SMART
ZnF_C2H2	723	745	4.54e-4	SMART
ZnF_C2H2	751	773	5.21e-4	SMART
low complexity region	774	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130145

SMART Domains

Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

Domain	Start	End	E-Value	Type
coiled coil region	35	61	N/A	INTRINSIC
Pfam:EST1	99	204	1.3e-19	PFAM
Pfam:EST1_DNA_bind	212	339	7.3e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153226

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]

Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930567H17Rik	T	A	X: 70,394,207		probably benign	Het
4932429P05Rik	A	G	X: 89,754,320	H586R	probably benign	Het
9130409I23Rik	G	A	1: 181,055,379	M235I	probably benign	Het
Aff4	T	A	11: 53,410,953	L1043*	probably null	Het
Ankrd11	G	T	8: 122,895,836	R426S	probably damaging	Het
Atm	T	A	9: 53,456,566	N2422I	probably damaging	Het
Bahcc1	C	A	11: 120,272,841	P655Q	probably damaging	Het
Baz2a	A	G	10: 128,116,080	I556V	possibly damaging	Het
BC017643	C	T	11: 121,227,242		probably null	Het
Ccdc33	T	C	9: 58,082,048	D114G	probably damaging	Het
Cdk5rap2	T	C	4: 70,337,375	H424R	probably benign	Het
Cfap57	T	C	4: 118,581,102	E864G	possibly damaging	Het
Cit	T	A	5: 115,946,919	S836R	probably damaging	Het
Clip4	C	T	17: 71,837,699	Q95*	probably null	Het
Col17a1	C	T	19: 47,669,433	G433S	possibly damaging	Het
Col6a3	A	G	1: 90,828,298	F90L	probably damaging	Het
Dnah9	T	C	11: 66,107,898	H1108R	probably damaging	Het
Elac1	A	T	18: 73,739,039	M295K	probably damaging	Het
Epas1	G	T	17: 86,829,456	G816C	possibly damaging	Het
Ermap	C	A	4: 119,178,510	C427F	probably damaging	Het
Fbxo44	T	C	4: 148,158,809		probably benign	Het
Fmo4	T	A	1: 162,808,392	K14*	probably null	Het
Gadl1	G	A	9: 116,073,987	M461I	probably damaging	Het
Garnl3	T	A	2: 32,990,642	I868F	probably damaging	Het
Gm6614	G	T	6: 142,003,428	A74E	possibly damaging	Het
Gm7168	A	G	17: 13,948,983	D204G	probably damaging	Het
Hs6st3	T	C	14: 119,869,383	F401S	possibly damaging	Het
Kcnmb1	A	T	11: 33,964,701	M1L	probably benign	Het
Krt35	T	C	11: 100,093,794	T292A	probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lamb2	T	A	9: 108,483,794	W572R	probably benign	Het
Letmd1	A	G	15: 100,469,821	T87A	probably damaging	Het
Lrp2	A	G	2: 69,448,169	Y3947H	probably damaging	Het
Mocos	T	C	18: 24,688,987	F685L	probably damaging	Het
Nsun6	A	T	2: 14,996,474	F424I	probably damaging	Het
Nup88	A	G	11: 70,969,950	M1T	probably null	Het
Olfr1209	T	C	2: 88,910,273	N40S	probably damaging	Het
Olfr1339	C	T	4: 118,735,224	R232C	probably benign	Het
Olfr297	C	T	7: 86,526,987	P77S	probably damaging	Het
Pcdhb12	T	A	18: 37,437,709	V636D	probably damaging	Het
Pclo	C	A	5: 14,515,439	A73E	probably damaging	Het
Pdlim7	A	T	13: 55,504,880		probably null	Het
Phldb1	G	A	9: 44,699,636	P67S	possibly damaging	Het
Ppp2r2b	T	C	18: 43,059,192	T17A	probably benign	Het
Rab11fip4	T	C	11: 79,683,502	V241A	probably benign	Het
Slc41a1	T	C	1: 131,840,952	L216P	probably damaging	Het
Tbc1d9	A	T	8: 83,259,313	I816F	probably damaging	Het
Tex264	T	C	9: 106,659,299	T220A	probably benign	Het
Tmco6	G	A	18: 36,741,776	V439I	probably damaging	Het
Tmem64	A	G	4: 15,266,717	I256V	probably damaging	Het
Tnks1bp1	A	G	2: 85,052,536	S236G	possibly damaging	Het
Tsc1	A	G	2: 28,670,930	T267A	possibly damaging	Het
Txndc2	A	G	17: 65,639,553		probably null	Het
Vmn2r94	G	A	17: 18,277,433	Q26*	probably null	Het
Zan	T	C	5: 137,389,249	D4900G	unknown	Het
Zkscan3	T	C	13: 21,388,596	T122A	probably benign	Het

Other mutations in Smg6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Smg6	APN	11	74929148	missense	probably benign
IGL01146:Smg6	APN	11	74930428	nonsense	probably null
IGL01505:Smg6	APN	11	75156291	missense	probably damaging	1.00
IGL01541:Smg6	APN	11	74925944	missense	probably benign	0.43
IGL01636:Smg6	APN	11	74935103	critical splice donor site	probably null
IGL02379:Smg6	APN	11	75053925	missense	probably damaging	1.00
IGL02794:Smg6	APN	11	75053934	missense	probably damaging	0.99
IGL02964:Smg6	APN	11	74930750	critical splice donor site	probably null
IGL03057:Smg6	APN	11	74935434	nonsense	probably null
1mM(1):Smg6	UTSW	11	74934989	splice site	probably benign
IGL03097:Smg6	UTSW	11	74932426	missense	probably damaging	1.00
PIT4802001:Smg6	UTSW	11	75156165	missense	probably damaging	0.96
R0269:Smg6	UTSW	11	75162931	missense	probably benign
R0344:Smg6	UTSW	11	74929821	missense	probably damaging	1.00
R0437:Smg6	UTSW	11	74929701	missense	probably damaging	1.00
R0452:Smg6	UTSW	11	74930213	missense	probably benign
R0511:Smg6	UTSW	11	74929058	missense	probably damaging	1.00
R0617:Smg6	UTSW	11	75162931	missense	probably benign
R1715:Smg6	UTSW	11	74929430	missense	probably benign
R1780:Smg6	UTSW	11	74946116	missense	probably damaging	1.00
R1927:Smg6	UTSW	11	75142848	missense	probably damaging	1.00
R2073:Smg6	UTSW	11	74930294	missense	probably damaging	1.00
R2171:Smg6	UTSW	11	75038646	missense	probably damaging	1.00
R2513:Smg6	UTSW	11	74929676	missense	probably damaging	1.00
R3943:Smg6	UTSW	11	74929541	missense	probably damaging	1.00
R3944:Smg6	UTSW	11	74929541	missense	probably damaging	1.00
R4275:Smg6	UTSW	11	74993874	intron	probably benign
R4369:Smg6	UTSW	11	74932443	nonsense	probably null
R4452:Smg6	UTSW	11	74990141	missense	probably benign	0.14
R4864:Smg6	UTSW	11	74930162	missense	possibly damaging	0.89
R4885:Smg6	UTSW	11	75041918	missense	probably damaging	1.00
R5043:Smg6	UTSW	11	74929895	missense	possibly damaging	0.86
R5189:Smg6	UTSW	11	75041996	missense	probably damaging	1.00
R5378:Smg6	UTSW	11	75041994	missense	possibly damaging	0.61
R5518:Smg6	UTSW	11	75053898	missense	probably damaging	0.99
R5725:Smg6	UTSW	11	74930613	missense	probably benign	0.45
R5746:Smg6	UTSW	11	75139287	missense	probably damaging	1.00
R6151:Smg6	UTSW	11	75156207	missense	probably damaging	0.96
R6319:Smg6	UTSW	11	75156222	missense	probably damaging	1.00
R6349:Smg6	UTSW	11	75053774	missense	possibly damaging	0.94
R6500:Smg6	UTSW	11	74930505	missense	possibly damaging	0.74
R6619:Smg6	UTSW	11	74932453	critical splice donor site	probably null
R6820:Smg6	UTSW	11	75041964	missense	probably damaging	0.99
R6923:Smg6	UTSW	11	74929343	missense	possibly damaging	0.50
R7361:Smg6	UTSW	11	74930153	missense	probably benign	0.00
R7494:Smg6	UTSW	11	74929623	missense	probably benign
R7498:Smg6	UTSW	11	74929106	missense	probably benign	0.01
R7681:Smg6	UTSW	11	74931705	missense	probably damaging	1.00
R7710:Smg6	UTSW	11	74930619	missense	probably benign	0.26
R7770:Smg6	UTSW	11	74993861	missense	unknown
R8159:Smg6	UTSW	11	75038639	missense	probably damaging	1.00
R8381:Smg6	UTSW	11	74931740	missense	probably damaging	1.00
R8463:Smg6	UTSW	11	74930060	missense	probably benign	0.14
R8509:Smg6	UTSW	11	75041876	missense	probably benign	0.04
R8557:Smg6	UTSW	11	75156238	missense	probably damaging	0.98
R8743:Smg6	UTSW	11	74930033	missense	probably benign
R9240:Smg6	UTSW	11	74935058	missense	probably damaging	1.00
R9312:Smg6	UTSW	11	74930051	missense	probably benign	0.27
X0018:Smg6	UTSW	11	74929986	missense	possibly damaging	0.76
Z1186:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1187:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1188:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1189:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1190:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1191:Smg6	UTSW	11	75156266	missense	probably benign	0.06
Z1192:Smg6	UTSW	11	75156266	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GGCAGCTAAAGGGTAGCCAACATC -3'
(R):5'- GCTTACAGCCTAGAGCAGGGTTTC -3'

Sequencing Primer
(F):5'- CAACATCAAGGCCCAGGAGG -3'
(R):5'- ATAGTCGGTCTAACCTCTGGGAAG -3'

Posted On

2013-09-30