Incidental Mutation 'R9307:Bsn'
ID 705280
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R9307 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 107973221-108067583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107992993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 920 (S920P)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035208
AA Change: S920P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: S920P

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 137,771,183 (GRCm39) D124A probably benign Het
Acd T C 8: 106,425,514 (GRCm39) D273G probably damaging Het
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
Adam15 T C 3: 89,254,790 (GRCm39) D90G possibly damaging Het
Adam2 A T 14: 66,287,921 (GRCm39) C392S probably damaging Het
Adam23 T A 1: 63,576,131 (GRCm39) N304K probably damaging Het
Adam34l A C 8: 44,079,304 (GRCm39) F307V probably benign Het
Aldh3b3 T C 19: 4,013,882 (GRCm39) F28L probably damaging Het
Btc A G 5: 91,550,515 (GRCm39) probably null Het
Chchd2 A T 5: 129,916,054 (GRCm39) V12E probably benign Het
Chia1 A G 3: 106,035,991 (GRCm39) probably benign Het
Chil4 A T 3: 106,111,382 (GRCm39) probably null Het
Clock A G 5: 76,364,671 (GRCm39) F815L unknown Het
Cmtr2 C T 8: 110,949,712 (GRCm39) T674M probably benign Het
Cnbd1 A C 4: 18,887,647 (GRCm39) I289R probably damaging Het
Cog2 A T 8: 125,253,837 (GRCm39) probably null Het
Col13a1 T C 10: 61,703,248 (GRCm39) I454V unknown Het
Cyct T A 2: 76,184,457 (GRCm39) Y98F probably benign Het
Dcaf6 T C 1: 165,227,236 (GRCm39) E297G possibly damaging Het
Dgka T C 10: 128,567,046 (GRCm39) H271R probably damaging Het
Dnah9 T A 11: 65,976,300 (GRCm39) I1250F probably benign Het
Dock4 T C 12: 40,686,155 (GRCm39) L130P probably damaging Het
Dpyd G A 3: 119,108,560 (GRCm39) V868I probably benign Het
Dync1li1 T A 9: 114,535,076 (GRCm39) D113E probably damaging Het
Fat3 T C 9: 15,932,719 (GRCm39) K1405E probably damaging Het
Fbn2 A G 18: 58,342,856 (GRCm39) C8R probably benign Het
Frmd4a A G 2: 4,609,044 (GRCm39) M971V probably benign Het
Glyatl3 C T 17: 41,223,553 (GRCm39) probably null Het
Grip1 A T 10: 119,821,454 (GRCm39) H373L probably benign Het
Ins1 T C 19: 52,253,258 (GRCm39) L66P possibly damaging Het
Kif21b A T 1: 136,101,800 (GRCm39) I1616L probably benign Het
Map7d1 A G 4: 126,128,024 (GRCm39) M637T unknown Het
Mc2r A T 18: 68,540,636 (GRCm39) M219K probably benign Het
Mcpt1 A G 14: 56,256,867 (GRCm39) D135G possibly damaging Het
Mturn T C 6: 54,676,541 (GRCm39) probably null Het
Mutyh T A 4: 116,674,074 (GRCm39) probably null Het
Myh3 A G 11: 66,984,397 (GRCm39) D1078G possibly damaging Het
Or4d5 T C 9: 40,012,451 (GRCm39) I112V probably benign Het
Pcdha12 A G 18: 37,153,874 (GRCm39) K198E probably damaging Het
Pcf11 A T 7: 92,306,534 (GRCm39) N1211K possibly damaging Het
Piezo1 G A 8: 123,213,832 (GRCm39) P1711S Het
Pkd1 T A 17: 24,769,451 (GRCm39) L72Q possibly damaging Het
Pramel20 C A 4: 143,299,314 (GRCm39) L326I probably damaging Het
Prss12 A G 3: 123,299,049 (GRCm39) D607G probably benign Het
R3hdml T C 2: 163,344,372 (GRCm39) *254R probably null Het
Rasal3 TTGGACCTGAGTGGA TTGGA 17: 32,612,502 (GRCm39) 782 probably null Het
Relch A T 1: 105,615,077 (GRCm39) Y272F probably benign Het
Rev3l C T 10: 39,693,149 (GRCm39) P410S probably benign Het
Sec14l2 A G 11: 4,068,665 (GRCm39) V5A probably benign Het
Slc12a3 A C 8: 95,061,625 (GRCm39) I291L probably benign Het
Slc4a10 T C 2: 62,083,662 (GRCm39) F372L probably damaging Het
Spta1 T C 1: 174,035,978 (GRCm39) W1095R probably damaging Het
Synj1 T C 16: 90,785,095 (GRCm39) T254A probably damaging Het
Taar2 T C 10: 23,817,237 (GRCm39) F259S probably damaging Het
Tns2 C A 15: 102,018,996 (GRCm39) L396I probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,540,648 (GRCm39) probably benign Het
Traf5 T C 1: 191,747,033 (GRCm39) D96G probably damaging Het
Trgv3 A G 13: 19,427,441 (GRCm39) E108G probably damaging Het
Trpv6 A G 6: 41,602,378 (GRCm39) V336A probably benign Het
Usp45 A T 4: 21,824,998 (GRCm39) L583F probably damaging Het
Utrn T C 10: 12,554,475 (GRCm39) D1538G probably benign Het
Vmn1r209 T A 13: 22,990,072 (GRCm39) H206L probably damaging Het
Zfp51 T A 17: 21,684,733 (GRCm39) H449Q probably benign Het
Zfp653 G A 9: 21,969,321 (GRCm39) S315F possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 107,992,309 (GRCm39) missense probably benign 0.01
IGL00330:Bsn APN 9 107,992,539 (GRCm39) missense probably damaging 1.00
IGL00863:Bsn APN 9 107,992,521 (GRCm39) missense probably damaging 1.00
IGL01123:Bsn APN 9 107,993,185 (GRCm39) missense probably damaging 1.00
IGL01330:Bsn APN 9 107,988,112 (GRCm39) unclassified probably benign
IGL01336:Bsn APN 9 107,988,984 (GRCm39) missense probably damaging 0.99
IGL01399:Bsn APN 9 107,984,386 (GRCm39) missense unknown
IGL01683:Bsn APN 9 107,992,095 (GRCm39) missense possibly damaging 0.71
IGL02022:Bsn APN 9 107,987,617 (GRCm39) unclassified probably benign
IGL02396:Bsn APN 9 107,993,245 (GRCm39) missense possibly damaging 0.90
IGL02538:Bsn APN 9 107,982,435 (GRCm39) missense unknown
IGL02565:Bsn APN 9 107,990,487 (GRCm39) missense probably damaging 0.99
IGL02661:Bsn APN 9 107,984,135 (GRCm39) nonsense probably null
IGL02739:Bsn APN 9 107,989,745 (GRCm39) missense probably benign 0.14
IGL02951:Bsn APN 9 107,992,812 (GRCm39) missense probably damaging 1.00
IGL02987:Bsn APN 9 108,003,503 (GRCm39) missense probably benign 0.03
IGL03033:Bsn APN 9 107,993,192 (GRCm39) missense probably damaging 1.00
IGL03069:Bsn APN 9 107,991,462 (GRCm39) missense probably damaging 1.00
IGL03076:Bsn APN 9 107,982,581 (GRCm39) missense unknown
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0068:Bsn UTSW 9 107,989,336 (GRCm39) missense probably damaging 1.00
R0167:Bsn UTSW 9 108,003,185 (GRCm39) missense probably benign 0.01
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0234:Bsn UTSW 9 107,993,595 (GRCm39) missense possibly damaging 0.50
R0359:Bsn UTSW 9 107,989,045 (GRCm39) missense possibly damaging 0.81
R0514:Bsn UTSW 9 108,002,981 (GRCm39) missense probably benign 0.07
R0593:Bsn UTSW 9 107,987,505 (GRCm39) missense unknown
R0617:Bsn UTSW 9 107,984,439 (GRCm39) missense unknown
R0636:Bsn UTSW 9 107,985,033 (GRCm39) missense unknown
R0652:Bsn UTSW 9 107,982,941 (GRCm39) missense unknown
R0718:Bsn UTSW 9 107,988,559 (GRCm39) unclassified probably benign
R0730:Bsn UTSW 9 107,984,011 (GRCm39) missense unknown
R0905:Bsn UTSW 9 107,982,834 (GRCm39) missense unknown
R0963:Bsn UTSW 9 107,989,006 (GRCm39) missense possibly damaging 0.81
R0992:Bsn UTSW 9 107,991,553 (GRCm39) nonsense probably null
R1101:Bsn UTSW 9 107,993,610 (GRCm39) missense probably damaging 1.00
R1393:Bsn UTSW 9 107,987,716 (GRCm39) unclassified probably benign
R1490:Bsn UTSW 9 107,991,193 (GRCm39) missense probably benign 0.03
R1566:Bsn UTSW 9 108,003,184 (GRCm39) missense probably benign 0.35
R1582:Bsn UTSW 9 107,982,291 (GRCm39) missense unknown
R1738:Bsn UTSW 9 107,984,133 (GRCm39) missense unknown
R1867:Bsn UTSW 9 107,983,918 (GRCm39) missense unknown
R1918:Bsn UTSW 9 107,984,772 (GRCm39) missense unknown
R1933:Bsn UTSW 9 107,993,643 (GRCm39) missense possibly damaging 0.91
R1946:Bsn UTSW 9 107,991,850 (GRCm39) missense probably damaging 0.99
R1978:Bsn UTSW 9 107,991,748 (GRCm39) missense probably benign 0.35
R2068:Bsn UTSW 9 108,003,749 (GRCm39) missense possibly damaging 0.95
R2068:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R2113:Bsn UTSW 9 107,992,085 (GRCm39) missense probably benign 0.14
R2136:Bsn UTSW 9 107,990,430 (GRCm39) missense probably damaging 1.00
R2172:Bsn UTSW 9 107,987,191 (GRCm39) intron probably benign
R2266:Bsn UTSW 9 107,992,323 (GRCm39) missense probably damaging 1.00
R2293:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2294:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2368:Bsn UTSW 9 107,988,229 (GRCm39) nonsense probably null
R2442:Bsn UTSW 9 107,984,119 (GRCm39) missense unknown
R2507:Bsn UTSW 9 107,993,313 (GRCm39) missense probably damaging 1.00
R2880:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2881:Bsn UTSW 9 107,990,266 (GRCm39) missense possibly damaging 0.47
R2922:Bsn UTSW 9 107,992,668 (GRCm39) missense probably damaging 1.00
R2922:Bsn UTSW 9 107,985,385 (GRCm39) missense unknown
R3618:Bsn UTSW 9 107,994,760 (GRCm39) critical splice acceptor site probably null
R3742:Bsn UTSW 9 107,982,938 (GRCm39) missense unknown
R3825:Bsn UTSW 9 107,984,055 (GRCm39) missense unknown
R3982:Bsn UTSW 9 107,984,365 (GRCm39) missense unknown
R4094:Bsn UTSW 9 107,991,069 (GRCm39) missense probably damaging 1.00
R4158:Bsn UTSW 9 107,990,145 (GRCm39) missense possibly damaging 0.95
R4225:Bsn UTSW 9 107,983,932 (GRCm39) missense unknown
R4261:Bsn UTSW 9 107,987,883 (GRCm39) unclassified probably benign
R4482:Bsn UTSW 9 107,991,863 (GRCm39) missense probably damaging 1.00
R4515:Bsn UTSW 9 107,981,277 (GRCm39) splice site probably null
R4585:Bsn UTSW 9 107,987,662 (GRCm39) unclassified probably benign
R4628:Bsn UTSW 9 107,990,434 (GRCm39) missense probably damaging 1.00
R4636:Bsn UTSW 9 107,992,623 (GRCm39) missense probably damaging 1.00
R4679:Bsn UTSW 9 107,987,329 (GRCm39) missense unknown
R4723:Bsn UTSW 9 107,989,854 (GRCm39) missense probably benign 0.03
R4843:Bsn UTSW 9 107,984,388 (GRCm39) missense unknown
R4885:Bsn UTSW 9 107,984,726 (GRCm39) nonsense probably null
R4936:Bsn UTSW 9 107,988,960 (GRCm39) missense probably damaging 1.00
R4942:Bsn UTSW 9 107,983,678 (GRCm39) missense unknown
R4972:Bsn UTSW 9 107,992,377 (GRCm39) missense probably damaging 1.00
R4992:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R5067:Bsn UTSW 9 107,989,152 (GRCm39) missense probably damaging 1.00
R5206:Bsn UTSW 9 107,982,572 (GRCm39) missense unknown
R5286:Bsn UTSW 9 107,988,123 (GRCm39) unclassified probably benign
R5492:Bsn UTSW 9 107,989,714 (GRCm39) missense probably damaging 0.98
R5553:Bsn UTSW 9 107,987,620 (GRCm39) unclassified probably benign
R5561:Bsn UTSW 9 107,982,710 (GRCm39) missense unknown
R5597:Bsn UTSW 9 107,992,131 (GRCm39) missense probably benign 0.06
R5646:Bsn UTSW 9 107,987,631 (GRCm39) unclassified probably benign
R5796:Bsn UTSW 9 108,003,223 (GRCm39) missense probably damaging 1.00
R5801:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5802:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R5850:Bsn UTSW 9 107,992,149 (GRCm39) missense probably damaging 0.99
R5938:Bsn UTSW 9 107,990,208 (GRCm39) missense possibly damaging 0.81
R6221:Bsn UTSW 9 107,982,765 (GRCm39) missense unknown
R6243:Bsn UTSW 9 107,984,760 (GRCm39) missense unknown
R6254:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.96
R6263:Bsn UTSW 9 107,990,453 (GRCm39) missense probably damaging 1.00
R6345:Bsn UTSW 9 107,984,554 (GRCm39) missense unknown
R6368:Bsn UTSW 9 107,988,513 (GRCm39) unclassified probably benign
R6574:Bsn UTSW 9 107,991,153 (GRCm39) missense possibly damaging 0.95
R6793:Bsn UTSW 9 107,991,814 (GRCm39) nonsense probably null
R6802:Bsn UTSW 9 107,987,823 (GRCm39) unclassified probably benign
R6943:Bsn UTSW 9 107,985,016 (GRCm39) missense unknown
R6999:Bsn UTSW 9 107,990,632 (GRCm39) missense probably benign 0.00
R7149:Bsn UTSW 9 107,993,520 (GRCm39) nonsense probably null
R7199:Bsn UTSW 9 107,992,533 (GRCm39) missense probably damaging 1.00
R7322:Bsn UTSW 9 108,003,620 (GRCm39) nonsense probably null
R7349:Bsn UTSW 9 107,987,982 (GRCm39) missense unknown
R7372:Bsn UTSW 9 107,987,718 (GRCm39) missense unknown
R7373:Bsn UTSW 9 107,990,683 (GRCm39) missense probably damaging 1.00
R7413:Bsn UTSW 9 108,016,690 (GRCm39) missense possibly damaging 0.61
R7473:Bsn UTSW 9 107,989,449 (GRCm39) missense probably damaging 1.00
R7482:Bsn UTSW 9 107,990,728 (GRCm39) missense probably damaging 0.98
R7530:Bsn UTSW 9 107,989,155 (GRCm39) missense probably damaging 1.00
R7549:Bsn UTSW 9 107,992,014 (GRCm39) missense probably benign 0.05
R7570:Bsn UTSW 9 107,990,742 (GRCm39) missense probably damaging 1.00
R7635:Bsn UTSW 9 107,988,189 (GRCm39) missense unknown
R7696:Bsn UTSW 9 107,991,700 (GRCm39) missense probably damaging 1.00
R7757:Bsn UTSW 9 107,991,939 (GRCm39) missense possibly damaging 0.90
R7868:Bsn UTSW 9 107,992,098 (GRCm39) missense possibly damaging 0.95
R7897:Bsn UTSW 9 107,989,065 (GRCm39) missense probably damaging 0.98
R7960:Bsn UTSW 9 107,992,747 (GRCm39) missense probably damaging 1.00
R8022:Bsn UTSW 9 107,991,603 (GRCm39) missense probably benign 0.01
R8056:Bsn UTSW 9 107,982,506 (GRCm39) missense
R8158:Bsn UTSW 9 107,987,232 (GRCm39) missense unknown
R8161:Bsn UTSW 9 108,016,729 (GRCm39) missense probably benign 0.20
R8225:Bsn UTSW 9 107,984,305 (GRCm39) missense
R8282:Bsn UTSW 9 107,984,890 (GRCm39) missense possibly damaging 0.73
R8296:Bsn UTSW 9 107,994,578 (GRCm39) missense probably benign 0.00
R8415:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8417:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8426:Bsn UTSW 9 108,003,772 (GRCm39) missense probably damaging 1.00
R8437:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8438:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8439:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8440:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8441:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8442:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8513:Bsn UTSW 9 107,991,709 (GRCm39) missense possibly damaging 0.65
R8529:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8535:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8546:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8548:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8549:Bsn UTSW 9 107,988,651 (GRCm39) missense probably benign 0.00
R8682:Bsn UTSW 9 107,983,368 (GRCm39) missense
R8773:Bsn UTSW 9 107,987,704 (GRCm39) missense unknown
R8883:Bsn UTSW 9 107,990,227 (GRCm39) missense probably damaging 0.98
R8906:Bsn UTSW 9 107,984,752 (GRCm39) missense unknown
R9018:Bsn UTSW 9 107,994,488 (GRCm39) missense probably benign 0.06
R9070:Bsn UTSW 9 107,987,295 (GRCm39) missense
R9094:Bsn UTSW 9 107,988,052 (GRCm39) missense unknown
R9098:Bsn UTSW 9 107,990,173 (GRCm39) missense possibly damaging 0.65
R9128:Bsn UTSW 9 107,993,349 (GRCm39) missense probably benign 0.21
R9162:Bsn UTSW 9 107,987,883 (GRCm39) missense unknown
R9224:Bsn UTSW 9 107,982,686 (GRCm39) missense
R9230:Bsn UTSW 9 107,989,459 (GRCm39) missense probably damaging 1.00
R9233:Bsn UTSW 9 107,994,289 (GRCm39) missense probably benign 0.28
R9245:Bsn UTSW 9 107,993,292 (GRCm39) missense probably damaging 1.00
R9275:Bsn UTSW 9 107,988,819 (GRCm39) missense probably damaging 1.00
R9343:Bsn UTSW 9 107,992,701 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,993,361 (GRCm39) missense probably damaging 1.00
R9377:Bsn UTSW 9 107,990,800 (GRCm39) missense probably damaging 1.00
R9378:Bsn UTSW 9 107,984,854 (GRCm39) missense possibly damaging 0.85
R9408:Bsn UTSW 9 108,016,652 (GRCm39) nonsense probably null
R9455:Bsn UTSW 9 107,988,531 (GRCm39) missense unknown
R9563:Bsn UTSW 9 107,984,616 (GRCm39) missense
R9615:Bsn UTSW 9 107,984,430 (GRCm39) missense
R9656:Bsn UTSW 9 107,994,407 (GRCm39) missense probably benign 0.09
R9698:Bsn UTSW 9 107,993,170 (GRCm39) missense probably damaging 1.00
X0028:Bsn UTSW 9 107,990,703 (GRCm39) missense probably damaging 1.00
X0066:Bsn UTSW 9 108,016,409 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 108,016,394 (GRCm39) missense probably damaging 1.00
Z1177:Bsn UTSW 9 107,982,698 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TATAGCTAGGTGTGGAGGCC -3'
(R):5'- CCTAGAAATGAGTGCCGAGG -3'

Sequencing Primer
(F):5'- GCAACGTAGAGGAGTGCTC -3'
(R):5'- TGCCGAGGAAGACAACTTG -3'
Posted On 2022-03-25