Incidental Mutation 'R9307:Bsn'
ID 705280
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
MMRRC Submission
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Essential gene? Probably non essential (E-score: 0.248) question?
Stock # R9307 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108096022-108190384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108115794 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 920 (S920P)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035208
AA Change: S920P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: S920P

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,422 D124A probably benign Het
2310035C23Rik A T 1: 105,687,352 Y272F probably benign Het
Acd T C 8: 105,698,882 D273G probably damaging Het
Adam15 T C 3: 89,347,483 D90G possibly damaging Het
Adam2 A T 14: 66,050,472 C392S probably damaging Het
Adam23 T A 1: 63,536,972 N304K probably damaging Het
Aldh3b3 T C 19: 3,963,882 F28L probably damaging Het
BC080695 C A 4: 143,572,744 L326I probably damaging Het
Btc A G 5: 91,402,656 probably null Het
Chchd2 A T 5: 129,887,213 V12E probably benign Het
Chia1 A G 3: 106,128,675 probably benign Het
Chil4 A T 3: 106,204,066 probably null Het
Clock A G 5: 76,216,824 F815L unknown Het
Cmtr2 C T 8: 110,223,080 T674M probably benign Het
Cnbd1 A C 4: 18,887,647 I289R probably damaging Het
Cog2 A T 8: 124,527,098 probably null Het
Col13a1 T C 10: 61,867,469 I454V unknown Het
Cyct T A 2: 76,354,113 Y98F probably benign Het
Dcaf6 T C 1: 165,399,667 E297G possibly damaging Het
Dgka T C 10: 128,731,177 H271R probably damaging Het
Dnah9 T A 11: 66,085,474 I1250F probably benign Het
Dock4 T C 12: 40,636,156 L130P probably damaging Het
Dpyd G A 3: 119,314,911 V868I probably benign Het
Dync1li1 T A 9: 114,706,008 D113E probably damaging Het
Fat3 T C 9: 16,021,423 K1405E probably damaging Het
Fbn2 A G 18: 58,209,784 C8R probably benign Het
Frmd4a A G 2: 4,604,233 M971V probably benign Het
Glyatl3 C T 17: 40,912,662 probably null Het
Gm498 G T 7: 143,881,165 probably null Het
Gm5346 A C 8: 43,626,267 F307V probably benign Het
Grip1 A T 10: 119,985,549 H373L probably benign Het
Ins1 T C 19: 52,264,820 L66P possibly damaging Het
Kif21b A T 1: 136,174,062 I1616L probably benign Het
Map7d1 A G 4: 126,234,231 M637T unknown Het
Mc2r A T 18: 68,407,565 M219K probably benign Het
Mcpt1 A G 14: 56,019,410 D135G possibly damaging Het
Mturn T C 6: 54,699,556 probably null Het
Mutyh T A 4: 116,816,877 probably null Het
Myh3 A G 11: 67,093,571 D1078G possibly damaging Het
Olfr984 T C 9: 40,101,155 I112V probably benign Het
Pcdha12 A G 18: 37,020,821 K198E probably damaging Het
Pcf11 A T 7: 92,657,326 N1211K possibly damaging Het
Piezo1 G A 8: 122,487,093 P1711S Het
Pkd1 T A 17: 24,550,477 L72Q possibly damaging Het
Prss12 A G 3: 123,505,400 D607G probably benign Het
R3hdml T C 2: 163,502,452 *254R probably null Het
Rasal3 TTGGACCTGAGTGGA TTGGA 17: 32,393,528 782 probably null Het
Rev3l C T 10: 39,817,153 P410S probably benign Het
Sec14l2 A G 11: 4,118,665 V5A probably benign Het
Slc12a3 A C 8: 94,334,997 I291L probably benign Het
Slc4a10 T C 2: 62,253,318 F372L probably damaging Het
Spta1 T C 1: 174,208,412 W1095R probably damaging Het
Synj1 T C 16: 90,988,207 T254A probably damaging Het
Taar2 T C 10: 23,941,339 F259S probably damaging Het
Tcrg-V3 A G 13: 19,243,271 E108G probably damaging Het
Tns2 C A 15: 102,110,561 L396I probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,649,822 probably benign Het
Traf5 T C 1: 192,062,733 D96G probably damaging Het
Trpv6 A G 6: 41,625,444 V336A probably benign Het
Usp45 A T 4: 21,824,998 L583F probably damaging Het
Utrn T C 10: 12,678,731 D1538G probably benign Het
Vmn1r209 T A 13: 22,805,902 H206L probably damaging Het
Zfp51 T A 17: 21,464,471 H449Q probably benign Het
Zfp653 G A 9: 22,058,025 S315F possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8225:Bsn UTSW 9 108107106 missense
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8682:Bsn UTSW 9 108106169 missense
R8773:Bsn UTSW 9 108110505 missense unknown
R8883:Bsn UTSW 9 108113028 missense probably damaging 0.98
R8906:Bsn UTSW 9 108107553 missense unknown
R9018:Bsn UTSW 9 108117289 missense probably benign 0.06
R9070:Bsn UTSW 9 108110096 missense
R9094:Bsn UTSW 9 108110853 missense unknown
R9098:Bsn UTSW 9 108112974 missense possibly damaging 0.65
R9128:Bsn UTSW 9 108116150 missense probably benign 0.21
R9162:Bsn UTSW 9 108110684 missense unknown
R9224:Bsn UTSW 9 108105487 missense
R9230:Bsn UTSW 9 108112260 missense probably damaging 1.00
R9233:Bsn UTSW 9 108117090 missense probably benign 0.28
R9245:Bsn UTSW 9 108116093 missense probably damaging 1.00
R9275:Bsn UTSW 9 108111620 missense probably damaging 1.00
R9343:Bsn UTSW 9 108115502 missense probably damaging 1.00
R9377:Bsn UTSW 9 108113601 missense probably damaging 1.00
R9377:Bsn UTSW 9 108116162 missense probably damaging 1.00
R9378:Bsn UTSW 9 108107655 missense possibly damaging 0.85
R9408:Bsn UTSW 9 108139453 nonsense probably null
R9455:Bsn UTSW 9 108111332 missense unknown
R9563:Bsn UTSW 9 108107417 missense
R9615:Bsn UTSW 9 108107231 missense
R9656:Bsn UTSW 9 108117208 missense probably benign 0.09
R9698:Bsn UTSW 9 108115971 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGCTAGGTGTGGAGGCC -3'
(R):5'- CCTAGAAATGAGTGCCGAGG -3'

Sequencing Primer
(F):5'- GCAACGTAGAGGAGTGCTC -3'
(R):5'- TGCCGAGGAAGACAACTTG -3'
Posted On 2022-03-25