Incidental Mutation 'R9307:Grip1'
ID 705286
Institutional Source Beutler Lab
Gene Symbol Grip1
Ensembl Gene ENSMUSG00000034813
Gene Name glutamate receptor interacting protein 1
Synonyms eb
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9307 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 119453830-120087261 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119985549 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 373 (H373L)
Ref Sequence ENSEMBL: ENSMUSP00000123234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041962] [ENSMUST00000077871] [ENSMUST00000105262] [ENSMUST00000138410] [ENSMUST00000144825] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000147454] [ENSMUST00000148954]
AlphaFold Q925T6
PDB Structure Solution Structure of the PDZ Domain from Mouse Glutamate Receptor Interacting Protein 1A-L (GRIP1) Homolog [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000041962
SMART Domains Protein: ENSMUSP00000042436
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 354 367 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
PDZ 429 509 6.36e-17 SMART
PDZ 530 606 1.11e-16 SMART
PDZ 629 703 1.73e-18 SMART
PDZ 947 1019 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077871
SMART Domains Protein: ENSMUSP00000077033
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 36 110 4.86e-13 SMART
PDZ 134 212 6.4e-22 SMART
PDZ 235 310 1.97e-13 SMART
low complexity region 327 340 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 386 397 N/A INTRINSIC
PDZ 402 482 6.36e-17 SMART
PDZ 503 579 1.11e-16 SMART
PDZ 602 676 1.73e-18 SMART
PDZ 920 992 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105262
SMART Domains Protein: ENSMUSP00000100897
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 946 1018 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138410
AA Change: H373L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123234
Gene: ENSMUSG00000034813
AA Change: H373L

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 1013 1085 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144825
SMART Domains Protein: ENSMUSP00000121670
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 35 109 4.86e-13 SMART
PDZ 133 211 6.4e-22 SMART
PDZ 234 309 1.97e-13 SMART
low complexity region 326 339 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
PDZ 401 481 6.36e-17 SMART
PDZ 502 578 1.11e-16 SMART
PDZ 601 675 1.73e-18 SMART
PDZ 919 991 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144959
AA Change: H373L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813
AA Change: H373L

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147356
AA Change: H374L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813
AA Change: H374L

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147454
AA Change: H373L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118073
Gene: ENSMUSG00000034813
AA Change: H373L

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148954
SMART Domains Protein: ENSMUSP00000118397
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 353 366 N/A INTRINSIC
low complexity region 387 404 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
PDZ 428 508 6.36e-17 SMART
PDZ 529 605 1.11e-16 SMART
PDZ 628 702 1.73e-18 SMART
PDZ 961 1033 2.79e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein containing multiple PDZ (post synaptic density protein, Drosophila disc large tumor suppressor, and zonula occludens-1 protein) domains. The encoded protein acts as a mediator between cytoskeletal and membrane proteins, particularly in neuronal cells, and facilitates complex formation at the cell membrane. Mutation of this gene can cause embryonic lethality resulting from defects of the dermo-epidermal junction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous ablation of gene function results in embryonic lethality and blistering skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,422 D124A probably benign Het
2310035C23Rik A T 1: 105,687,352 Y272F probably benign Het
Acd T C 8: 105,698,882 D273G probably damaging Het
Adam15 T C 3: 89,347,483 D90G possibly damaging Het
Adam2 A T 14: 66,050,472 C392S probably damaging Het
Adam23 T A 1: 63,536,972 N304K probably damaging Het
Aldh3b3 T C 19: 3,963,882 F28L probably damaging Het
BC080695 C A 4: 143,572,744 L326I probably damaging Het
Bsn A G 9: 108,115,794 S920P probably benign Het
Btc A G 5: 91,402,656 probably null Het
Chchd2 A T 5: 129,887,213 V12E probably benign Het
Chil4 A T 3: 106,204,066 probably null Het
Clock A G 5: 76,216,824 F815L unknown Het
Cmtr2 C T 8: 110,223,080 T674M probably benign Het
Cnbd1 A C 4: 18,887,647 I289R probably damaging Het
Cog2 A T 8: 124,527,098 probably null Het
Col13a1 T C 10: 61,867,469 I454V unknown Het
Cyct T A 2: 76,354,113 Y98F probably benign Het
Dcaf6 T C 1: 165,399,667 E297G possibly damaging Het
Dgka T C 10: 128,731,177 H271R probably damaging Het
Dnah9 T A 11: 66,085,474 I1250F probably benign Het
Dock4 T C 12: 40,636,156 L130P probably damaging Het
Dpyd G A 3: 119,314,911 V868I probably benign Het
Dync1li1 T A 9: 114,706,008 D113E probably damaging Het
Fat3 T C 9: 16,021,423 K1405E probably damaging Het
Fbn2 A G 18: 58,209,784 C8R probably benign Het
Frmd4a A G 2: 4,604,233 M971V probably benign Het
Glyatl3 C T 17: 40,912,662 probably null Het
Gm498 G T 7: 143,881,165 probably null Het
Gm5346 A C 8: 43,626,267 F307V probably benign Het
Ins1 T C 19: 52,264,820 L66P possibly damaging Het
Kif21b A T 1: 136,174,062 I1616L probably benign Het
Map7d1 A G 4: 126,234,231 M637T unknown Het
Mc2r A T 18: 68,407,565 M219K probably benign Het
Mcpt1 A G 14: 56,019,410 D135G possibly damaging Het
Mturn T C 6: 54,699,556 probably null Het
Mutyh T A 4: 116,816,877 probably null Het
Myh3 A G 11: 67,093,571 D1078G possibly damaging Het
Olfr984 T C 9: 40,101,155 I112V probably benign Het
Pcdha12 A G 18: 37,020,821 K198E probably damaging Het
Pcf11 A T 7: 92,657,326 N1211K possibly damaging Het
Piezo1 G A 8: 122,487,093 P1711S Het
Pkd1 T A 17: 24,550,477 L72Q possibly damaging Het
Prss12 A G 3: 123,505,400 D607G probably benign Het
R3hdml T C 2: 163,502,452 *254R probably null Het
Rasal3 TTGGACCTGAGTGGA TTGGA 17: 32,393,528 probably null Het
Rev3l C T 10: 39,817,153 P410S probably benign Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Sec14l2 A G 11: 4,118,665 V5A probably benign Het
Slc12a3 A C 8: 94,334,997 I291L probably benign Het
Slc4a10 T C 2: 62,253,318 F372L probably damaging Het
Spta1 T C 1: 174,208,412 W1095R probably damaging Het
Synj1 T C 16: 90,988,207 T254A probably damaging Het
Taar2 T C 10: 23,941,339 F259S probably damaging Het
Tcrg-V3 A G 13: 19,243,271 E108G probably damaging Het
Tns2 C A 15: 102,110,561 L396I probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,649,822 probably benign Het
Traf5 T C 1: 192,062,733 D96G probably damaging Het
Trpv6 A G 6: 41,625,444 V336A probably benign Het
Usp45 A T 4: 21,824,998 L583F probably damaging Het
Utrn T C 10: 12,678,731 D1538G probably benign Het
Vmn1r209 T A 13: 22,805,902 H206L probably damaging Het
Zfp51 T A 17: 21,464,471 H449Q probably benign Het
Zfp653 G A 9: 22,058,025 S315F possibly damaging Het
Other mutations in Grip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Grip1 APN 10 119931302 nonsense probably null
IGL01374:Grip1 APN 10 120049368 missense probably benign 0.03
IGL01592:Grip1 APN 10 119930003 missense probably damaging 1.00
IGL02207:Grip1 APN 10 120075309 missense probably damaging 1.00
IGL02222:Grip1 APN 10 119999809 missense probably damaging 1.00
IGL02225:Grip1 APN 10 120049453 missense probably damaging 1.00
IGL02447:Grip1 APN 10 120020071 missense probably damaging 1.00
IGL02492:Grip1 APN 10 119930040 splice site probably benign
IGL02522:Grip1 APN 10 119931249 missense probably damaging 1.00
IGL02574:Grip1 APN 10 119942913 missense probably damaging 1.00
IGL02718:Grip1 APN 10 120075515 makesense probably null
IGL02751:Grip1 APN 10 119978577 missense probably benign 0.08
IGL03221:Grip1 APN 10 119986394 missense probably benign 0.00
IGL03377:Grip1 APN 10 120055032 missense probably damaging 0.98
PIT4403001:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R0304:Grip1 UTSW 10 120075471 missense probably benign 0.31
R0681:Grip1 UTSW 10 120010230 missense probably damaging 1.00
R0760:Grip1 UTSW 10 120018078 missense probably damaging 0.96
R1457:Grip1 UTSW 10 119986350 missense possibly damaging 0.73
R1506:Grip1 UTSW 10 119978451 missense probably damaging 1.00
R1541:Grip1 UTSW 10 120000543 missense probably damaging 0.99
R1553:Grip1 UTSW 10 120054851 missense probably damaging 1.00
R1709:Grip1 UTSW 10 119897715 missense probably damaging 0.98
R2055:Grip1 UTSW 10 120049511 splice site probably benign
R2059:Grip1 UTSW 10 120038698 missense possibly damaging 0.80
R2261:Grip1 UTSW 10 119985584 missense probably benign 0.00
R2475:Grip1 UTSW 10 119978496 missense probably benign 0.01
R3777:Grip1 UTSW 10 119985630 critical splice donor site probably null
R3849:Grip1 UTSW 10 119929958 missense probably damaging 1.00
R3956:Grip1 UTSW 10 119930026 missense probably damaging 1.00
R4643:Grip1 UTSW 10 120020101 missense probably damaging 1.00
R4693:Grip1 UTSW 10 120000554 missense probably benign 0.10
R4724:Grip1 UTSW 10 120038683 missense probably benign 0.02
R4843:Grip1 UTSW 10 119930015 missense probably damaging 1.00
R4884:Grip1 UTSW 10 120075306 missense probably damaging 1.00
R4912:Grip1 UTSW 10 119931248 missense probably damaging 1.00
R5185:Grip1 UTSW 10 119931259 missense probably benign 0.37
R5291:Grip1 UTSW 10 120086969 missense probably benign 0.04
R5293:Grip1 UTSW 10 119897735 missense probably damaging 0.99
R5296:Grip1 UTSW 10 119929928 missense probably damaging 1.00
R5302:Grip1 UTSW 10 120020077 missense probably damaging 1.00
R5541:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R5792:Grip1 UTSW 10 119985480 missense probably benign 0.07
R5861:Grip1 UTSW 10 119929970 missense probably damaging 1.00
R5905:Grip1 UTSW 10 119985492 missense probably benign 0.02
R5949:Grip1 UTSW 10 120050242 missense probably benign 0.00
R6112:Grip1 UTSW 10 119993232 missense probably benign 0.00
R6166:Grip1 UTSW 10 120072718 missense probably damaging 1.00
R6167:Grip1 UTSW 10 119897797 critical splice donor site probably null
R6193:Grip1 UTSW 10 120038314 missense probably damaging 1.00
R6218:Grip1 UTSW 10 119986346 missense possibly damaging 0.95
R6267:Grip1 UTSW 10 120075464 nonsense probably null
R6296:Grip1 UTSW 10 120075464 nonsense probably null
R6490:Grip1 UTSW 10 119986424 missense possibly damaging 0.82
R6543:Grip1 UTSW 10 119985594 missense probably benign 0.00
R6558:Grip1 UTSW 10 119454383 missense probably benign 0.00
R6995:Grip1 UTSW 10 119986470 missense probably damaging 0.99
R7122:Grip1 UTSW 10 120035374 missense possibly damaging 0.48
R7157:Grip1 UTSW 10 119945156 missense probably damaging 1.00
R7410:Grip1 UTSW 10 120020020 missense probably benign 0.01
R7447:Grip1 UTSW 10 120086966 missense probably benign 0.01
R7539:Grip1 UTSW 10 120054871 missense probably benign 0.17
R7586:Grip1 UTSW 10 120077138 splice site probably null
R7768:Grip1 UTSW 10 120038397 missense probably damaging 0.98
R7831:Grip1 UTSW 10 120018106 missense probably damaging 1.00
R7896:Grip1 UTSW 10 119978545 missense possibly damaging 0.53
R8103:Grip1 UTSW 10 119978535 missense probably benign 0.00
R8254:Grip1 UTSW 10 120054905 nonsense probably null
R8688:Grip1 UTSW 10 119999904 missense probably benign 0.12
R8823:Grip1 UTSW 10 119975951 missense
R8837:Grip1 UTSW 10 119930035 missense probably damaging 1.00
R8885:Grip1 UTSW 10 119454287 start gained probably benign
R8951:Grip1 UTSW 10 120038604 missense possibly damaging 0.85
R9042:Grip1 UTSW 10 120000533 missense probably benign 0.14
R9045:Grip1 UTSW 10 120035451 missense probably damaging 0.97
R9237:Grip1 UTSW 10 120075405 missense probably benign 0.07
R9254:Grip1 UTSW 10 119945056 missense probably damaging 1.00
R9259:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
R9260:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
R9379:Grip1 UTSW 10 119945056 missense probably damaging 1.00
R9546:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
R9547:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
R9548:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
R9549:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
R9583:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
R9584:Grip1 UTSW 10 120038664 missense possibly damaging 0.63
RF011:Grip1 UTSW 10 119931315 missense probably null 0.97
Z1176:Grip1 UTSW 10 119819483 unclassified probably benign
Z1177:Grip1 UTSW 10 119986444 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAAGCAGCTCCCATTTCTG -3'
(R):5'- ACCCATGAAACCAGAGATGTAG -3'

Sequencing Primer
(F):5'- AAGCAGCTCCCATTTCTGTTAACG -3'
(R):5'- TGAAACCAGAGATGTAGTGTGTTAG -3'
Posted On 2022-03-25