Incidental Mutation 'R0737:Krt35'
ID70530
Institutional Source Beutler Lab
Gene Symbol Krt35
Ensembl Gene ENSMUSG00000048013
Gene Namekeratin 35
SynonymsKrt1-24, Ha5
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R0737 (G1)
Quality Score104
Status Not validated
Chromosome11
Chromosomal Location100092193-100096241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100093794 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 292 (T292A)
Ref Sequence ENSEMBL: ENSMUSP00000099416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103127]
Predicted Effect probably benign
Transcript: ENSMUST00000103127
AA Change: T292A

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099416
Gene: ENSMUSG00000048013
AA Change: T292A

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Filament 96 407 3.32e-159 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173988
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Krt35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Krt35 APN 11 100093959 missense probably damaging 1.00
IGL01528:Krt35 APN 11 100094594 missense probably damaging 1.00
IGL02552:Krt35 APN 11 100093073 missense probably benign 0.39
IGL02583:Krt35 APN 11 100092534 missense possibly damaging 0.66
IGL03276:Krt35 APN 11 100093127 missense probably benign 0.39
R0011:Krt35 UTSW 11 100093676 missense probably benign 0.10
R0282:Krt35 UTSW 11 100095747 missense probably damaging 0.99
R0692:Krt35 UTSW 11 100093070 missense possibly damaging 0.92
R0750:Krt35 UTSW 11 100096153 missense possibly damaging 0.69
R1815:Krt35 UTSW 11 100095739 missense probably benign 0.02
R2218:Krt35 UTSW 11 100096162 missense probably null
R2262:Krt35 UTSW 11 100095767 missense probably benign 0.01
R4519:Krt35 UTSW 11 100094627 missense possibly damaging 0.50
R4575:Krt35 UTSW 11 100095899 missense probably benign 0.40
R4599:Krt35 UTSW 11 100094008 missense probably damaging 1.00
R4887:Krt35 UTSW 11 100093130 missense probably damaging 1.00
R5140:Krt35 UTSW 11 100094517 missense probably damaging 1.00
R5159:Krt35 UTSW 11 100094049 missense probably damaging 1.00
R5575:Krt35 UTSW 11 100094624 missense probably damaging 1.00
R5909:Krt35 UTSW 11 100095813 missense probably damaging 0.99
R6738:Krt35 UTSW 11 100093709 missense probably damaging 1.00
R7090:Krt35 UTSW 11 100095672 splice site probably null
R7163:Krt35 UTSW 11 100096158 missense probably damaging 0.99
R7797:Krt35 UTSW 11 100094887 missense probably damaging 1.00
R8716:Krt35 UTSW 11 100096185 start codon destroyed probably null 0.98
Z1177:Krt35 UTSW 11 100096057 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTGGTTCAGCAGATGTTCCACCC -3'
(R):5'- AACCGCGTTCTGGATGAGATGAGG -3'

Sequencing Primer
(F):5'- GCAGATGTTCCACCCCTTCC -3'
(R):5'- GCTGAAGACTGGTATGACACCC -3'
Posted On2013-09-30