Incidental Mutation 'R9307:Aldh3b3'
ID 705306
Institutional Source Beutler Lab
Gene Symbol Aldh3b3
Ensembl Gene ENSMUSG00000037263
Gene Name aldehyde dehydrogenase 3 family, member B3
Synonyms 1700055N04Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock # R9307 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 3958645-3972103 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3963882 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 28 (F28L)
Ref Sequence ENSEMBL: ENSMUSP00000136334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179433] [ENSMUST00000189124]
AlphaFold J3QMK6
Predicted Effect probably benign
Transcript: ENSMUST00000025794
SMART Domains Protein: ENSMUSP00000025794
Gene: ENSMUSG00000037263

DomainStartEndE-ValueType
PDB:4L2O|G 1 87 5e-22 PDB
SCOP:d1ad3a_ 8 82 2e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179433
AA Change: F28L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136334
Gene: ENSMUSG00000037263
AA Change: F28L

DomainStartEndE-ValueType
Pfam:Aldedh 6 441 5.4e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189124
AA Change: F28L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140893
Gene: ENSMUSG00000037263
AA Change: F28L

DomainStartEndE-ValueType
SCOP:d1ad3a_ 18 72 2e-8 SMART
PDB:1AD3|B 19 67 1e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,422 D124A probably benign Het
2310035C23Rik A T 1: 105,687,352 Y272F probably benign Het
Acd T C 8: 105,698,882 D273G probably damaging Het
Adam15 T C 3: 89,347,483 D90G possibly damaging Het
Adam2 A T 14: 66,050,472 C392S probably damaging Het
Adam23 T A 1: 63,536,972 N304K probably damaging Het
BC080695 C A 4: 143,572,744 L326I probably damaging Het
Bsn A G 9: 108,115,794 S920P probably benign Het
Btc A G 5: 91,402,656 probably null Het
Chchd2 A T 5: 129,887,213 V12E probably benign Het
Chil4 A T 3: 106,204,066 probably null Het
Clock A G 5: 76,216,824 F815L unknown Het
Cmtr2 C T 8: 110,223,080 T674M probably benign Het
Cnbd1 A C 4: 18,887,647 I289R probably damaging Het
Cog2 A T 8: 124,527,098 probably null Het
Col13a1 T C 10: 61,867,469 I454V unknown Het
Cyct T A 2: 76,354,113 Y98F probably benign Het
Dcaf6 T C 1: 165,399,667 E297G possibly damaging Het
Dgka T C 10: 128,731,177 H271R probably damaging Het
Dnah9 T A 11: 66,085,474 I1250F probably benign Het
Dock4 T C 12: 40,636,156 L130P probably damaging Het
Dpyd G A 3: 119,314,911 V868I probably benign Het
Dync1li1 T A 9: 114,706,008 D113E probably damaging Het
Fat3 T C 9: 16,021,423 K1405E probably damaging Het
Fbn2 A G 18: 58,209,784 C8R probably benign Het
Frmd4a A G 2: 4,604,233 M971V probably benign Het
Glyatl3 C T 17: 40,912,662 probably null Het
Gm498 G T 7: 143,881,165 probably null Het
Gm5346 A C 8: 43,626,267 F307V probably benign Het
Grip1 A T 10: 119,985,549 H373L probably benign Het
Ins1 T C 19: 52,264,820 L66P possibly damaging Het
Kif21b A T 1: 136,174,062 I1616L probably benign Het
Map7d1 A G 4: 126,234,231 M637T unknown Het
Mc2r A T 18: 68,407,565 M219K probably benign Het
Mcpt1 A G 14: 56,019,410 D135G possibly damaging Het
Mturn T C 6: 54,699,556 probably null Het
Mutyh T A 4: 116,816,877 probably null Het
Myh3 A G 11: 67,093,571 D1078G possibly damaging Het
Olfr984 T C 9: 40,101,155 I112V probably benign Het
Pcdha12 A G 18: 37,020,821 K198E probably damaging Het
Pcf11 A T 7: 92,657,326 N1211K possibly damaging Het
Piezo1 G A 8: 122,487,093 P1711S Het
Pkd1 T A 17: 24,550,477 L72Q possibly damaging Het
Prss12 A G 3: 123,505,400 D607G probably benign Het
R3hdml T C 2: 163,502,452 *254R probably null Het
Rasal3 TTGGACCTGAGTGGA TTGGA 17: 32,393,528 probably null Het
Rev3l C T 10: 39,817,153 P410S probably benign Het
Rptn GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA GCAAGACCAGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTTCTCACCAGGGTCA 3: 93,396,693 probably benign Het
Sec14l2 A G 11: 4,118,665 V5A probably benign Het
Slc12a3 A C 8: 94,334,997 I291L probably benign Het
Slc4a10 T C 2: 62,253,318 F372L probably damaging Het
Spta1 T C 1: 174,208,412 W1095R probably damaging Het
Synj1 T C 16: 90,988,207 T254A probably damaging Het
Taar2 T C 10: 23,941,339 F259S probably damaging Het
Tcrg-V3 A G 13: 19,243,271 E108G probably damaging Het
Tns2 C A 15: 102,110,561 L396I probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,649,822 probably benign Het
Traf5 T C 1: 192,062,733 D96G probably damaging Het
Trpv6 A G 6: 41,625,444 V336A probably benign Het
Usp45 A T 4: 21,824,998 L583F probably damaging Het
Utrn T C 10: 12,678,731 D1538G probably benign Het
Vmn1r209 T A 13: 22,805,902 H206L probably damaging Het
Zfp51 T A 17: 21,464,471 H449Q probably benign Het
Zfp653 G A 9: 22,058,025 S315F possibly damaging Het
Other mutations in Aldh3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Aldh3b3 APN 19 3965863 missense probably benign 0.02
R0395:Aldh3b3 UTSW 19 3966472 missense probably benign 0.00
R0762:Aldh3b3 UTSW 19 3965747 splice site probably null
R1722:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
R1754:Aldh3b3 UTSW 19 3968517 missense probably benign
R1853:Aldh3b3 UTSW 19 3965822 missense probably damaging 1.00
R1901:Aldh3b3 UTSW 19 3965130 missense probably damaging 1.00
R3924:Aldh3b3 UTSW 19 3968491 missense probably damaging 1.00
R4578:Aldh3b3 UTSW 19 3964832 missense probably benign
R4689:Aldh3b3 UTSW 19 3964516 missense probably damaging 0.97
R5632:Aldh3b3 UTSW 19 3968522 utr 3 prime probably benign
R5635:Aldh3b3 UTSW 19 3968512 missense probably benign 0.17
R7422:Aldh3b3 UTSW 19 3966476 missense probably benign 0.01
R7478:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7481:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7717:Aldh3b3 UTSW 19 3963970 missense probably damaging 1.00
R7863:Aldh3b3 UTSW 19 3965322 nonsense probably null
R7868:Aldh3b3 UTSW 19 3968492 nonsense probably null
R7895:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
R8745:Aldh3b3 UTSW 19 3964890 missense possibly damaging 0.95
R9093:Aldh3b3 UTSW 19 3963959 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGTCCACCAGCGTTCAGAAG -3'
(R):5'- GGAGTGATAGAACAGCACCTCTG -3'

Sequencing Primer
(F):5'- GCGTTCAGAAGCACTCAGC -3'
(R):5'- CACCTCTGTGTGTCCAAGGATG -3'
Posted On 2022-03-25