Incidental Mutation 'R9309:Ptpro'
ID 705387
Institutional Source Beutler Lab
Gene Symbol Ptpro
Ensembl Gene ENSMUSG00000030223
Gene Name protein tyrosine phosphatase receptor type O
Synonyms Ptpn15, PTP-BK, D28, PTPROt, PTP-phi, PTP-U2, GLEPP1, PTP-oc
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9309 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 137229317-137440231 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 137431656 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1172 (V1172M)
Ref Sequence ENSEMBL: ENSMUSP00000076364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077115] [ENSMUST00000167002] [ENSMUST00000167679] [ENSMUST00000203914]
AlphaFold E9Q612
Predicted Effect probably damaging
Transcript: ENSMUST00000077115
AA Change: V1172M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000076364
Gene: ENSMUSG00000030223
AA Change: V1172M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
PTPc 947 1207 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167002
AA Change: V351M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131764
Gene: ENSMUSG00000030223
AA Change: V351M

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
PTPc 126 386 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167679
AA Change: V1144M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127112
Gene: ENSMUSG00000030223
AA Change: V1144M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 269 291 N/A INTRINSIC
FN3 443 528 1.07e-1 SMART
FN3 540 626 7.07e-2 SMART
FN3 642 722 4.47e1 SMART
FN3 733 812 5.92e-4 SMART
transmembrane domain 831 853 N/A INTRINSIC
PTPc 919 1179 1.43e-127 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203914
AA Change: V323M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144870
Gene: ENSMUSG00000030223
AA Change: V323M

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
PTPc 98 358 6.1e-130 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the R3 subtype family of receptor-type protein tyrosine phosphatases. These proteins are localized to the apical surface of polarized cells and may have tissue-specific functions through activation of Src family kinases. This gene contains two distinct promoters, and alternatively spliced transcript variants encoding multiple isoforms have been observed. The encoded proteins may have multiple isoform-specific and tissue-specific functions, including the regulation of osteoclast production and activity, inhibition of cell proliferation and facilitation of apoptosis. This gene is a candidate tumor suppressor, and decreased expression of this gene has been observed in several types of cancer. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for one allele display impaired glomerular filtration due to podocyte structural anomalies and a predisposition for hypertension. Mice homozygous for a second allele exhibit susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C A 5: 88,120,332 (GRCm39) P363Q probably damaging Het
Acy3 C T 19: 4,038,451 (GRCm39) R193W probably damaging Het
Adam11 C T 11: 102,663,710 (GRCm39) T296M probably damaging Het
Ak9 T C 10: 41,192,364 (GRCm39) probably null Het
Angpt2 A T 8: 18,749,172 (GRCm39) M315K probably damaging Het
Bpifa6 A T 2: 153,834,207 (GRCm39) D333V probably benign Het
Brsk1 T C 7: 4,709,118 (GRCm39) probably null Het
Btn2a2 T A 13: 23,662,981 (GRCm39) H323L probably damaging Het
Cct8 G A 16: 87,282,592 (GRCm39) A442V probably damaging Het
Cdc20b T C 13: 113,216,472 (GRCm39) V317A probably damaging Het
Cfh A T 1: 140,082,249 (GRCm39) S211T probably damaging Het
Chd9 G A 8: 91,733,319 (GRCm39) R1396H unknown Het
Cobll1 A G 2: 64,956,271 (GRCm39) V329A probably damaging Het
Cope T C 8: 70,755,482 (GRCm39) V9A unknown Het
Ctnnb1 A T 9: 120,784,504 (GRCm39) Y432F probably benign Het
Ercc6 T A 14: 32,240,904 (GRCm39) C143S probably damaging Het
H2-M10.1 T C 17: 36,636,525 (GRCm39) E93G probably benign Het
Haao T C 17: 84,146,270 (GRCm39) E68G probably damaging Het
Hbq1b G A 11: 32,237,408 (GRCm39) probably null Het
Itgb5 T C 16: 33,740,416 (GRCm39) Y509H probably benign Het
Klc4 T C 17: 46,947,550 (GRCm39) N384S probably damaging Het
Lemd2 A T 17: 27,411,936 (GRCm39) V452E probably damaging Het
Lrit2 C A 14: 36,793,848 (GRCm39) A304E probably benign Het
Lrrc7 C T 3: 157,915,361 (GRCm39) W218* probably null Het
Mrpl39 C T 16: 84,532,071 (GRCm39) R12Q unknown Het
Msln A G 17: 25,970,148 (GRCm39) V269A possibly damaging Het
Nf1 T G 11: 79,359,595 (GRCm39) M1411R possibly damaging Het
Obscn C T 11: 58,943,337 (GRCm39) E4271K probably damaging Het
Optc G T 1: 133,825,682 (GRCm39) S334R probably benign Het
Or14j9 A G 17: 37,875,049 (GRCm39) L51P probably damaging Het
Or5h18 A G 16: 58,848,186 (GRCm39) F28S probably damaging Het
Or7g26 A G 9: 19,230,444 (GRCm39) I211V probably benign Het
Patl1 C A 19: 11,913,082 (GRCm39) R542S probably damaging Het
Pcdhb19 T C 18: 37,631,858 (GRCm39) V551A probably damaging Het
Pkhd1l1 G A 15: 44,400,289 (GRCm39) M2144I probably benign Het
Polr3a T G 14: 24,510,067 (GRCm39) N956H probably benign Het
Prkdc C A 16: 15,526,792 (GRCm39) C1354* probably null Het
Ptpdc1 A G 13: 48,736,607 (GRCm39) V721A probably benign Het
Reln A T 5: 22,176,866 (GRCm39) N1933K probably benign Het
Rev1 A G 1: 38,093,945 (GRCm39) V1016A probably damaging Het
Ryr2 T G 13: 11,721,578 (GRCm39) K2618Q probably damaging Het
Spata31h1 T C 10: 82,130,986 (GRCm39) T675A probably benign Het
Tenm3 A T 8: 48,751,972 (GRCm39) M948K probably damaging Het
Tex48 G T 4: 63,530,105 (GRCm39) T38N probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,540,648 (GRCm39) probably benign Het
Try10 G T 6: 41,333,559 (GRCm39) K101N probably benign Het
Ttc6 A G 12: 57,753,649 (GRCm39) Y1476C possibly damaging Het
Urb2 T C 8: 124,754,809 (GRCm39) V172A probably damaging Het
Wdfy4 C T 14: 32,817,313 (GRCm39) G1544R Het
Zeb2 T A 2: 44,892,575 (GRCm39) E226V probably damaging Het
Zfp423 T A 8: 88,509,688 (GRCm39) I219F probably damaging Het
Zkscan1 A G 5: 138,091,666 (GRCm39) D133G probably damaging Het
Zscan4b G T 7: 10,635,856 (GRCm39) T157K possibly damaging Het
Other mutations in Ptpro
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Ptpro APN 6 137,371,907 (GRCm39) critical splice donor site probably null
IGL00844:Ptpro APN 6 137,391,237 (GRCm39) missense probably damaging 1.00
IGL00983:Ptpro APN 6 137,395,246 (GRCm39) missense probably benign 0.01
IGL01073:Ptpro APN 6 137,354,086 (GRCm39) missense probably damaging 1.00
IGL01832:Ptpro APN 6 137,370,666 (GRCm39) missense possibly damaging 0.93
IGL02308:Ptpro APN 6 137,431,698 (GRCm39) missense probably benign 0.37
IGL02387:Ptpro APN 6 137,387,978 (GRCm39) missense probably damaging 0.96
IGL02605:Ptpro APN 6 137,357,316 (GRCm39) missense probably benign 0.02
IGL02666:Ptpro APN 6 137,355,057 (GRCm39) missense probably damaging 0.96
IGL03275:Ptpro APN 6 137,427,004 (GRCm39) missense probably damaging 1.00
Brau UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
court UTSW 6 137,370,673 (GRCm39) nonsense probably null
Hoff UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
Jester UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
mann UTSW 6 137,388,114 (GRCm39) splice site probably null
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0017:Ptpro UTSW 6 137,393,825 (GRCm39) missense probably benign 0.03
R0020:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0022:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0023:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0024:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0094:Ptpro UTSW 6 137,363,350 (GRCm39) missense probably benign 0.08
R0103:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0106:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0316:Ptpro UTSW 6 137,353,987 (GRCm39) missense possibly damaging 0.81
R0427:Ptpro UTSW 6 137,345,294 (GRCm39) missense possibly damaging 0.81
R0456:Ptpro UTSW 6 137,391,228 (GRCm39) missense probably benign 0.04
R0536:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0537:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0552:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0555:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0664:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0708:Ptpro UTSW 6 137,363,251 (GRCm39) missense probably benign 0.26
R0730:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0735:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0738:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0786:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0811:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0812:Ptpro UTSW 6 137,345,077 (GRCm39) missense probably benign 0.00
R0881:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R0973:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1145:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1146:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1147:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1259:Ptpro UTSW 6 137,369,739 (GRCm39) missense probably damaging 0.98
R1340:Ptpro UTSW 6 137,418,079 (GRCm39) missense possibly damaging 0.95
R1381:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1382:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1385:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1396:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1401:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1416:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1422:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1448:Ptpro UTSW 6 137,418,114 (GRCm39) missense probably damaging 1.00
R1513:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1518:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1526:Ptpro UTSW 6 137,438,724 (GRCm39) missense probably damaging 1.00
R1540:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1571:Ptpro UTSW 6 137,355,128 (GRCm39) missense probably benign
R1573:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1587:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1588:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1649:Ptpro UTSW 6 137,421,015 (GRCm39) nonsense probably null
R1700:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1701:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1745:Ptpro UTSW 6 137,377,643 (GRCm39) missense probably benign 0.03
R1772:Ptpro UTSW 6 137,407,741 (GRCm39) missense probably damaging 1.00
R1911:Ptpro UTSW 6 137,377,617 (GRCm39) splice site probably benign
R1958:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R1967:Ptpro UTSW 6 137,393,863 (GRCm39) missense probably benign 0.38
R2025:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2026:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2040:Ptpro UTSW 6 137,363,162 (GRCm39) splice site probably benign
R2115:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2117:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R2130:Ptpro UTSW 6 137,388,114 (GRCm39) splice site probably null
R2161:Ptpro UTSW 6 137,426,885 (GRCm39) missense probably benign 0.01
R2431:Ptpro UTSW 6 137,420,583 (GRCm39) nonsense probably null
R2915:Ptpro UTSW 6 137,391,239 (GRCm39) start gained probably benign
R2988:Ptpro UTSW 6 137,420,597 (GRCm39) nonsense probably null
R3772:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3773:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3795:Ptpro UTSW 6 137,357,307 (GRCm39) missense probably benign
R3885:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3886:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3887:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3888:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R3893:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4032:Ptpro UTSW 6 137,438,740 (GRCm39) missense probably damaging 1.00
R4133:Ptpro UTSW 6 137,397,370 (GRCm39) missense probably damaging 1.00
R4377:Ptpro UTSW 6 137,357,264 (GRCm39) missense probably benign 0.26
R4455:Ptpro UTSW 6 137,370,657 (GRCm39) missense probably damaging 1.00
R4613:Ptpro UTSW 6 137,393,834 (GRCm39) nonsense probably null
R4827:Ptpro UTSW 6 137,419,708 (GRCm39) missense probably damaging 1.00
R4863:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R4870:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R4910:Ptpro UTSW 6 137,345,336 (GRCm39) missense probably damaging 0.99
R4932:Ptpro UTSW 6 137,388,103 (GRCm39) nonsense probably null
R4941:Ptpro UTSW 6 137,369,763 (GRCm39) missense probably damaging 1.00
R4989:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5009:Ptpro UTSW 6 137,354,130 (GRCm39) missense probably damaging 0.96
R5032:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5033:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5162:Ptpro UTSW 6 137,420,592 (GRCm39) missense probably damaging 1.00
R5393:Ptpro UTSW 6 137,357,222 (GRCm39) missense probably benign 0.04
R5423:Ptpro UTSW 6 137,419,705 (GRCm39) missense probably damaging 1.00
R5782:Ptpro UTSW 6 137,376,496 (GRCm39) missense possibly damaging 0.80
R6103:Ptpro UTSW 6 137,377,704 (GRCm39) missense possibly damaging 0.76
R6239:Ptpro UTSW 6 137,357,606 (GRCm39) missense probably benign 0.28
R6488:Ptpro UTSW 6 137,370,673 (GRCm39) nonsense probably null
R6494:Ptpro UTSW 6 137,359,640 (GRCm39) missense probably benign 0.20
R6746:Ptpro UTSW 6 137,371,821 (GRCm39) missense probably damaging 1.00
R6763:Ptpro UTSW 6 137,395,279 (GRCm39) splice site probably null
R6888:Ptpro UTSW 6 137,357,198 (GRCm39) missense probably benign 0.30
R6983:Ptpro UTSW 6 137,426,915 (GRCm39) missense probably damaging 1.00
R7019:Ptpro UTSW 6 137,357,476 (GRCm39) missense probably benign
R7218:Ptpro UTSW 6 137,431,596 (GRCm39) missense probably damaging 1.00
R7236:Ptpro UTSW 6 137,345,335 (GRCm39) missense probably damaging 1.00
R7299:Ptpro UTSW 6 137,418,142 (GRCm39) critical splice donor site probably null
R7381:Ptpro UTSW 6 137,376,559 (GRCm39) missense possibly damaging 0.93
R7493:Ptpro UTSW 6 137,359,647 (GRCm39) missense probably benign 0.01
R7733:Ptpro UTSW 6 137,391,284 (GRCm39) nonsense probably null
R7793:Ptpro UTSW 6 137,393,818 (GRCm39) missense probably damaging 0.99
R7804:Ptpro UTSW 6 137,376,599 (GRCm39) splice site probably null
R7833:Ptpro UTSW 6 137,393,861 (GRCm39) nonsense probably null
R7859:Ptpro UTSW 6 137,369,805 (GRCm39) critical splice donor site probably null
R7873:Ptpro UTSW 6 137,407,737 (GRCm39) missense probably benign 0.44
R8042:Ptpro UTSW 6 137,393,881 (GRCm39) missense possibly damaging 0.71
R8859:Ptpro UTSW 6 137,403,782 (GRCm39) nonsense probably null
R8979:Ptpro UTSW 6 137,345,140 (GRCm39) missense probably benign
R9138:Ptpro UTSW 6 137,388,113 (GRCm39) critical splice donor site probably null
R9420:Ptpro UTSW 6 137,420,933 (GRCm39) missense probably benign 0.08
R9612:Ptpro UTSW 6 137,391,318 (GRCm39) missense probably benign 0.31
R9625:Ptpro UTSW 6 137,371,873 (GRCm39) missense probably damaging 1.00
R9697:Ptpro UTSW 6 137,363,288 (GRCm39) missense probably damaging 1.00
R9715:Ptpro UTSW 6 137,345,108 (GRCm39) missense probably damaging 0.96
Z1177:Ptpro UTSW 6 137,355,138 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCCAGCTAAGTGCAAG -3'
(R):5'- GGGTAGTTTCAAATATGCACAGC -3'

Sequencing Primer
(F):5'- GGAGAACAGGTTCCCCCTTTC -3'
(R):5'- TTCAAATATGCACAGCAAGAAACTGG -3'
Posted On 2022-03-25