Incidental Mutation 'R0737:Vmn2r94'
ID70541
Institutional Source Beutler Lab
Gene Symbol Vmn2r94
Ensembl Gene ENSMUSG00000090417
Gene Namevomeronasal 2, receptor 94
SynonymsEG665227
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R0737 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location18240994-18277756 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 18277433 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 26 (Q26*)
Ref Sequence ENSEMBL: ENSMUSP00000156288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172190] [ENSMUST00000231457] [ENSMUST00000231815]
Predicted Effect probably null
Transcript: ENSMUST00000172190
AA Change: Q26*
SMART Domains Protein: ENSMUSP00000126386
Gene: ENSMUSG00000090417
AA Change: Q26*

DomainStartEndE-ValueType
Pfam:ANF_receptor 42 425 1.7e-35 PFAM
Pfam:NCD3G 469 522 3.5e-21 PFAM
Pfam:7tm_3 553 790 1.7e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231390
Predicted Effect probably null
Transcript: ENSMUST00000231457
AA Change: Q26*
Predicted Effect probably null
Transcript: ENSMUST00000231815
AA Change: Q26*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Txndc2 A G 17: 65,639,553 probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Vmn2r94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Vmn2r94 APN 17 18257039 missense probably damaging 1.00
IGL01676:Vmn2r94 APN 17 18257010 missense probably benign
IGL01687:Vmn2r94 APN 17 18253312 missense possibly damaging 0.64
IGL02113:Vmn2r94 APN 17 18257675 missense probably damaging 0.99
IGL02408:Vmn2r94 APN 17 18253261 missense probably benign 0.01
IGL02451:Vmn2r94 APN 17 18258191 missense possibly damaging 0.95
IGL02755:Vmn2r94 APN 17 18244499 missense probably benign 0.01
IGL02822:Vmn2r94 APN 17 18243620 missense probably benign 0.00
IGL02868:Vmn2r94 APN 17 18244054 missense possibly damaging 0.75
IGL03008:Vmn2r94 APN 17 18257646 missense probably benign 0.05
R0112:Vmn2r94 UTSW 17 18243604 missense probably benign
R0371:Vmn2r94 UTSW 17 18257294 missense probably benign 0.11
R0413:Vmn2r94 UTSW 17 18243818 missense probably damaging 0.98
R0627:Vmn2r94 UTSW 17 18257165 missense probably damaging 1.00
R0815:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R0863:Vmn2r94 UTSW 17 18257711 missense probably damaging 1.00
R1125:Vmn2r94 UTSW 17 18257455 missense probably damaging 1.00
R1276:Vmn2r94 UTSW 17 18257082 missense possibly damaging 0.47
R1491:Vmn2r94 UTSW 17 18257703 missense probably damaging 1.00
R1500:Vmn2r94 UTSW 17 18256980 missense probably benign 0.07
R1610:Vmn2r94 UTSW 17 18243733 missense probably damaging 1.00
R1664:Vmn2r94 UTSW 17 18244144 missense probably damaging 0.99
R1716:Vmn2r94 UTSW 17 18257373 missense probably benign 0.01
R1843:Vmn2r94 UTSW 17 18244470 missense probably benign 0.01
R1882:Vmn2r94 UTSW 17 18244214 missense probably benign 0.07
R1936:Vmn2r94 UTSW 17 18244292 nonsense probably null
R2273:Vmn2r94 UTSW 17 18257331 missense probably benign 0.00
R2508:Vmn2r94 UTSW 17 18257474 missense probably benign 0.32
R3436:Vmn2r94 UTSW 17 18258388 splice site probably benign
R3917:Vmn2r94 UTSW 17 18244358 missense probably benign
R3968:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R3969:Vmn2r94 UTSW 17 18258385 missense possibly damaging 0.95
R4257:Vmn2r94 UTSW 17 18244171 missense probably damaging 1.00
R4271:Vmn2r94 UTSW 17 18243678 missense probably damaging 1.00
R4349:Vmn2r94 UTSW 17 18244343 missense probably benign 0.01
R4436:Vmn2r94 UTSW 17 18258383 missense probably damaging 1.00
R4603:Vmn2r94 UTSW 17 18257385 missense probably benign 0.33
R4821:Vmn2r94 UTSW 17 18257031 missense probably benign 0.02
R5288:Vmn2r94 UTSW 17 18244466 missense probably damaging 1.00
R5725:Vmn2r94 UTSW 17 18256227 missense possibly damaging 0.88
R5735:Vmn2r94 UTSW 17 18243804 missense probably damaging 1.00
R6066:Vmn2r94 UTSW 17 18257433 missense probably damaging 0.99
R6124:Vmn2r94 UTSW 17 18244059 missense probably benign 0.01
R6189:Vmn2r94 UTSW 17 18257734 missense probably benign 0.25
R6245:Vmn2r94 UTSW 17 18258123 missense probably damaging 1.00
R6574:Vmn2r94 UTSW 17 18256159 missense probably damaging 1.00
R7236:Vmn2r94 UTSW 17 18257549 missense possibly damaging 0.49
R7317:Vmn2r94 UTSW 17 18243620 missense probably benign 0.00
R7398:Vmn2r94 UTSW 17 18257341 missense probably benign 0.00
R7399:Vmn2r94 UTSW 17 18244503 critical splice acceptor site probably null
R7478:Vmn2r94 UTSW 17 18257505 missense probably benign
R8099:Vmn2r94 UTSW 17 18257397 missense probably benign 0.00
R8189:Vmn2r94 UTSW 17 18258356 missense probably damaging 1.00
R8217:Vmn2r94 UTSW 17 18243724 missense probably damaging 1.00
R8303:Vmn2r94 UTSW 17 18244171 missense probably damaging 1.00
R8543:Vmn2r94 UTSW 17 18243722 missense possibly damaging 0.45
R8684:Vmn2r94 UTSW 17 18277650 start gained probably benign
R8889:Vmn2r94 UTSW 17 18244073 missense possibly damaging 0.83
R8892:Vmn2r94 UTSW 17 18244073 missense possibly damaging 0.83
RF014:Vmn2r94 UTSW 17 18253287 nonsense probably null
X0011:Vmn2r94 UTSW 17 18244448 missense possibly damaging 0.76
X0028:Vmn2r94 UTSW 17 18243975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTTATGGTTAACAATCCAACCAGGA -3'
(R):5'- CGGGCATCAGCAGCAGTCTAAAA -3'

Sequencing Primer
(F):5'- GTGAAAGTAGTCAAAGTTTCCACTTG -3'
(R):5'- CAAGCTGACCCATGTATTACTAGG -3'
Posted On2013-09-30