Mutagenetix > Incidental Mutation

Incidental Mutation 'R9309:Polr3a'

705410

Institutional Source

Beutler Lab

Gene Symbol

Polr3a

Ensembl Gene

ENSMUSG00000025280

Gene Name

polymerase (RNA) III (DNA directed) polypeptide A

Synonyms

RPC1, 9330175N20Rik, RPC155

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9309 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24448696-24487058 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 24459999 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 956 (N956H)

Ref Sequence

ENSEMBL: ENSMUSP00000026322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]

AlphaFold

B2RXC6

Predicted Effect

probably benign
Transcript: ENSMUST00000026322
AA Change: N956H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: N956H

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223718

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	C	A	5: 87,972,473	P363Q	probably damaging	Het
4932415D10Rik	T	C	10: 82,295,152	T675A	probably benign	Het
Acy3	C	T	19: 3,988,451	R193W	probably damaging	Het
Adam11	C	T	11: 102,772,884	T296M	probably damaging	Het
Ak9	T	C	10: 41,316,368		probably null	Het
Angpt2	A	T	8: 18,699,156	M315K	probably damaging	Het
Bpifa6	A	T	2: 153,992,287	D333V	probably benign	Het
Brsk1	T	C	7: 4,706,119		probably null	Het
Btn2a2	T	A	13: 23,478,811	H323L	probably damaging	Het
Cct8	G	A	16: 87,485,704	A442V	probably damaging	Het
Cdc20b	T	C	13: 113,079,938	V317A	probably damaging	Het
Cfh	A	T	1: 140,154,511	S211T	probably damaging	Het
Chd9	G	A	8: 91,006,691	R1396H	unknown	Het
Cobll1	A	G	2: 65,125,927	V329A	probably damaging	Het
Cope	T	C	8: 70,302,832	V9A	unknown	Het
Ctnnb1	A	T	9: 120,955,438	Y432F	probably benign	Het
Ercc6	T	A	14: 32,518,947	C143S	probably damaging	Het
H2-M10.1	T	C	17: 36,325,633	E93G	probably benign	Het
Haao	T	C	17: 83,838,841	E68G	probably damaging	Het
Hbq1b	G	A	11: 32,287,408		probably null	Het
Itgb5	T	C	16: 33,920,046	Y509H	probably benign	Het
Klc4	T	C	17: 46,636,624	N384S	probably damaging	Het
Lemd2	A	T	17: 27,192,962	V452E	probably damaging	Het
Lrit2	C	A	14: 37,071,891	A304E	probably benign	Het
Lrrc7	C	T	3: 158,209,724	W218*	probably null	Het
Mrpl39	C	T	16: 84,735,183	R12Q	unknown	Het
Msln	A	G	17: 25,751,174	V269A	possibly damaging	Het
Nf1	T	G	11: 79,468,769	M1411R	possibly damaging	Het
Obscn	C	T	11: 59,052,511	E4271K	probably damaging	Het
Olfr112	A	G	17: 37,564,158	L51P	probably damaging	Het
Olfr186	A	G	16: 59,027,823	F28S	probably damaging	Het
Olfr844	A	G	9: 19,319,148	I211V	probably benign	Het
Optc	G	T	1: 133,897,944	S334R	probably benign	Het
Patl1	C	A	19: 11,935,718	R542S	probably damaging	Het
Pcdhb19	T	C	18: 37,498,805	V551A	probably damaging	Het
Pkhd1l1	G	A	15: 44,536,893	M2144I	probably benign	Het
Prkdc	C	A	16: 15,708,928	C1354*	probably null	Het
Ptpdc1	A	G	13: 48,583,131	V721A	probably benign	Het
Ptpro	G	A	6: 137,454,658	V1172M	probably damaging	Het
Reln	A	T	5: 21,971,868	N1933K	probably benign	Het
Rev1	A	G	1: 38,054,864	V1016A	probably damaging	Het
Ryr2	T	G	13: 11,706,692	K2618Q	probably damaging	Het
Tenm3	A	T	8: 48,298,937	M948K	probably damaging	Het
Tex48	G	T	4: 63,611,868	T38N	probably damaging	Het
Tom1l1	TTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTG	11: 90,649,822		probably benign	Het
Try10	G	T	6: 41,356,625	K101N	probably benign	Het
Ttc6	A	G	12: 57,706,863	Y1476C	possibly damaging	Het
Urb2	T	C	8: 124,028,070	V172A	probably damaging	Het
Wdfy4	C	T	14: 33,095,356	G1544R		Het
Zeb2	T	A	2: 45,002,563	E226V	probably damaging	Het
Zfp423	T	A	8: 87,783,060	I219F	probably damaging	Het
Zkscan1	A	G	5: 138,093,404	D133G	probably damaging	Het
Zscan4b	G	T	7: 10,901,929	T157K	possibly damaging	Het

Other mutations in Polr3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Polr3a	APN	14	24475863	missense	probably benign	0.35
IGL00974:Polr3a	APN	14	24479424	missense	probably benign	0.05
IGL01348:Polr3a	APN	14	24461763	missense	probably damaging	1.00
IGL01464:Polr3a	APN	14	24470681	splice site	probably benign
IGL01785:Polr3a	APN	14	24484120	nonsense	probably null
IGL01786:Polr3a	APN	14	24484120	nonsense	probably null
IGL01936:Polr3a	APN	14	24479188	missense	probably damaging	1.00
IGL02095:Polr3a	APN	14	24454610	missense	possibly damaging	0.91
IGL02454:Polr3a	APN	14	24475823	missense	possibly damaging	0.87
IGL02702:Polr3a	APN	14	24470877	missense	probably benign	0.07
IGL02961:Polr3a	APN	14	24467040	nonsense	probably null
IGL03069:Polr3a	APN	14	24461740	missense	probably damaging	0.99
R0001:Polr3a	UTSW	14	24452189	splice site	probably benign
R0048:Polr3a	UTSW	14	24469255	splice site	probably benign
R0157:Polr3a	UTSW	14	24479186	missense	probably damaging	0.99
R0445:Polr3a	UTSW	14	24454921	missense	probably benign	0.00
R0449:Polr3a	UTSW	14	24484466	missense	probably damaging	0.99
R0597:Polr3a	UTSW	14	24484134	missense	probably benign	0.29
R0604:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0644:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0703:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0754:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0767:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0816:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0817:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0819:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R0840:Polr3a	UTSW	14	24452200	missense	possibly damaging	0.95
R1481:Polr3a	UTSW	14	24452548	missense	probably null	0.98
R1644:Polr3a	UTSW	14	24470624	missense	probably damaging	1.00
R1699:Polr3a	UTSW	14	24484164	missense	probably damaging	1.00
R1704:Polr3a	UTSW	14	24484120	nonsense	probably null
R2363:Polr3a	UTSW	14	24475892	splice site	probably null
R3419:Polr3a	UTSW	14	24467035	missense	probably damaging	1.00
R3934:Polr3a	UTSW	14	24476101	missense	probably benign	0.30
R4296:Polr3a	UTSW	14	24453196	missense	possibly damaging	0.82
R4611:Polr3a	UTSW	14	24452508	splice site	probably null
R4690:Polr3a	UTSW	14	24464281	missense	possibly damaging	0.78
R4934:Polr3a	UTSW	14	24452624	missense	probably benign	0.11
R4947:Polr3a	UTSW	14	24482464	missense	probably benign	0.00
R5232:Polr3a	UTSW	14	24453211	missense	probably benign	0.00
R5263:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5264:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5265:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5282:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5319:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5321:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5323:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5387:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5388:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5401:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5402:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5443:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5444:Polr3a	UTSW	14	24454941	missense	possibly damaging	0.65
R5725:Polr3a	UTSW	14	24465387	splice site	probably null
R5841:Polr3a	UTSW	14	24450698	missense	probably benign	0.00
R6408:Polr3a	UTSW	14	24486871	critical splice donor site	probably null
R6704:Polr3a	UTSW	14	24461842	missense	probably damaging	1.00
R7136:Polr3a	UTSW	14	24461815	missense	probably damaging	1.00
R7307:Polr3a	UTSW	14	24459987	missense	probably benign	0.03
R7368:Polr3a	UTSW	14	24467076	missense	probably damaging	0.98
R7800:Polr3a	UTSW	14	24484387	missense	probably null	0.83
R8753:Polr3a	UTSW	14	24463634	nonsense	probably null
R8785:Polr3a	UTSW	14	24452315	missense	probably benign	0.06
R8848:Polr3a	UTSW	14	24450766	missense	probably damaging	1.00
R9025:Polr3a	UTSW	14	24469411	missense	probably damaging	1.00
R9139:Polr3a	UTSW	14	24469348	missense	probably damaging	1.00
R9264:Polr3a	UTSW	14	24470831	missense	probably benign
R9363:Polr3a	UTSW	14	24450763	missense	probably damaging	1.00
R9526:Polr3a	UTSW	14	24453245	missense	probably benign	0.00
R9585:Polr3a	UTSW	14	24452221	missense	probably damaging	1.00
Z1088:Polr3a	UTSW	14	24479724	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGGTGACAAGGCTATACAGAC -3'
(R):5'- ACATGTCTTTCTGGTGCTCAGG -3'

Sequencing Primer
(F):5'- TCCAACACAGAGTCACTTGTGTG -3'
(R):5'- GCTCAGGCAGTGTATCCATGTC -3'

Posted On

2022-03-25