Incidental Mutation 'R9309:Polr3a'
ID 705410
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9309 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 24510067 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 956 (N956H)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect probably benign
Transcript: ENSMUST00000026322
AA Change: N956H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: N956H

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C A 5: 88,120,332 (GRCm39) P363Q probably damaging Het
Acy3 C T 19: 4,038,451 (GRCm39) R193W probably damaging Het
Adam11 C T 11: 102,663,710 (GRCm39) T296M probably damaging Het
Ak9 T C 10: 41,192,364 (GRCm39) probably null Het
Angpt2 A T 8: 18,749,172 (GRCm39) M315K probably damaging Het
Bpifa6 A T 2: 153,834,207 (GRCm39) D333V probably benign Het
Brsk1 T C 7: 4,709,118 (GRCm39) probably null Het
Btn2a2 T A 13: 23,662,981 (GRCm39) H323L probably damaging Het
Cct8 G A 16: 87,282,592 (GRCm39) A442V probably damaging Het
Cdc20b T C 13: 113,216,472 (GRCm39) V317A probably damaging Het
Cfh A T 1: 140,082,249 (GRCm39) S211T probably damaging Het
Chd9 G A 8: 91,733,319 (GRCm39) R1396H unknown Het
Cobll1 A G 2: 64,956,271 (GRCm39) V329A probably damaging Het
Cope T C 8: 70,755,482 (GRCm39) V9A unknown Het
Ctnnb1 A T 9: 120,784,504 (GRCm39) Y432F probably benign Het
Ercc6 T A 14: 32,240,904 (GRCm39) C143S probably damaging Het
H2-M10.1 T C 17: 36,636,525 (GRCm39) E93G probably benign Het
Haao T C 17: 84,146,270 (GRCm39) E68G probably damaging Het
Hbq1b G A 11: 32,237,408 (GRCm39) probably null Het
Itgb5 T C 16: 33,740,416 (GRCm39) Y509H probably benign Het
Klc4 T C 17: 46,947,550 (GRCm39) N384S probably damaging Het
Lemd2 A T 17: 27,411,936 (GRCm39) V452E probably damaging Het
Lrit2 C A 14: 36,793,848 (GRCm39) A304E probably benign Het
Lrrc7 C T 3: 157,915,361 (GRCm39) W218* probably null Het
Mrpl39 C T 16: 84,532,071 (GRCm39) R12Q unknown Het
Msln A G 17: 25,970,148 (GRCm39) V269A possibly damaging Het
Nf1 T G 11: 79,359,595 (GRCm39) M1411R possibly damaging Het
Obscn C T 11: 58,943,337 (GRCm39) E4271K probably damaging Het
Optc G T 1: 133,825,682 (GRCm39) S334R probably benign Het
Or14j9 A G 17: 37,875,049 (GRCm39) L51P probably damaging Het
Or5h18 A G 16: 58,848,186 (GRCm39) F28S probably damaging Het
Or7g26 A G 9: 19,230,444 (GRCm39) I211V probably benign Het
Patl1 C A 19: 11,913,082 (GRCm39) R542S probably damaging Het
Pcdhb19 T C 18: 37,631,858 (GRCm39) V551A probably damaging Het
Pkhd1l1 G A 15: 44,400,289 (GRCm39) M2144I probably benign Het
Prkdc C A 16: 15,526,792 (GRCm39) C1354* probably null Het
Ptpdc1 A G 13: 48,736,607 (GRCm39) V721A probably benign Het
Ptpro G A 6: 137,431,656 (GRCm39) V1172M probably damaging Het
Reln A T 5: 22,176,866 (GRCm39) N1933K probably benign Het
Rev1 A G 1: 38,093,945 (GRCm39) V1016A probably damaging Het
Ryr2 T G 13: 11,721,578 (GRCm39) K2618Q probably damaging Het
Spata31h1 T C 10: 82,130,986 (GRCm39) T675A probably benign Het
Tenm3 A T 8: 48,751,972 (GRCm39) M948K probably damaging Het
Tex48 G T 4: 63,530,105 (GRCm39) T38N probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,540,648 (GRCm39) probably benign Het
Try10 G T 6: 41,333,559 (GRCm39) K101N probably benign Het
Ttc6 A G 12: 57,753,649 (GRCm39) Y1476C possibly damaging Het
Urb2 T C 8: 124,754,809 (GRCm39) V172A probably damaging Het
Wdfy4 C T 14: 32,817,313 (GRCm39) G1544R Het
Zeb2 T A 2: 44,892,575 (GRCm39) E226V probably damaging Het
Zfp423 T A 8: 88,509,688 (GRCm39) I219F probably damaging Het
Zkscan1 A G 5: 138,091,666 (GRCm39) D133G probably damaging Het
Zscan4b G T 7: 10,635,856 (GRCm39) T157K possibly damaging Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGTGACAAGGCTATACAGAC -3'
(R):5'- ACATGTCTTTCTGGTGCTCAGG -3'

Sequencing Primer
(F):5'- TCCAACACAGAGTCACTTGTGTG -3'
(R):5'- GCTCAGGCAGTGTATCCATGTC -3'
Posted On 2022-03-25