Incidental Mutation 'R9309:Wdfy4'
ID 705412
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene Name WD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9309 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 32681504-32907465 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32817313 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 1544 (G1544R)
Ref Sequence ENSEMBL: ENSMUSP00000117068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000061753
AA Change: G1499R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: G1499R

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: G1544R

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik C A 5: 88,120,332 (GRCm39) P363Q probably damaging Het
Acy3 C T 19: 4,038,451 (GRCm39) R193W probably damaging Het
Adam11 C T 11: 102,663,710 (GRCm39) T296M probably damaging Het
Ak9 T C 10: 41,192,364 (GRCm39) probably null Het
Angpt2 A T 8: 18,749,172 (GRCm39) M315K probably damaging Het
Bpifa6 A T 2: 153,834,207 (GRCm39) D333V probably benign Het
Brsk1 T C 7: 4,709,118 (GRCm39) probably null Het
Btn2a2 T A 13: 23,662,981 (GRCm39) H323L probably damaging Het
Cct8 G A 16: 87,282,592 (GRCm39) A442V probably damaging Het
Cdc20b T C 13: 113,216,472 (GRCm39) V317A probably damaging Het
Cfh A T 1: 140,082,249 (GRCm39) S211T probably damaging Het
Chd9 G A 8: 91,733,319 (GRCm39) R1396H unknown Het
Cobll1 A G 2: 64,956,271 (GRCm39) V329A probably damaging Het
Cope T C 8: 70,755,482 (GRCm39) V9A unknown Het
Ctnnb1 A T 9: 120,784,504 (GRCm39) Y432F probably benign Het
Ercc6 T A 14: 32,240,904 (GRCm39) C143S probably damaging Het
H2-M10.1 T C 17: 36,636,525 (GRCm39) E93G probably benign Het
Haao T C 17: 84,146,270 (GRCm39) E68G probably damaging Het
Hbq1b G A 11: 32,237,408 (GRCm39) probably null Het
Itgb5 T C 16: 33,740,416 (GRCm39) Y509H probably benign Het
Klc4 T C 17: 46,947,550 (GRCm39) N384S probably damaging Het
Lemd2 A T 17: 27,411,936 (GRCm39) V452E probably damaging Het
Lrit2 C A 14: 36,793,848 (GRCm39) A304E probably benign Het
Lrrc7 C T 3: 157,915,361 (GRCm39) W218* probably null Het
Mrpl39 C T 16: 84,532,071 (GRCm39) R12Q unknown Het
Msln A G 17: 25,970,148 (GRCm39) V269A possibly damaging Het
Nf1 T G 11: 79,359,595 (GRCm39) M1411R possibly damaging Het
Obscn C T 11: 58,943,337 (GRCm39) E4271K probably damaging Het
Optc G T 1: 133,825,682 (GRCm39) S334R probably benign Het
Or14j9 A G 17: 37,875,049 (GRCm39) L51P probably damaging Het
Or5h18 A G 16: 58,848,186 (GRCm39) F28S probably damaging Het
Or7g26 A G 9: 19,230,444 (GRCm39) I211V probably benign Het
Patl1 C A 19: 11,913,082 (GRCm39) R542S probably damaging Het
Pcdhb19 T C 18: 37,631,858 (GRCm39) V551A probably damaging Het
Pkhd1l1 G A 15: 44,400,289 (GRCm39) M2144I probably benign Het
Polr3a T G 14: 24,510,067 (GRCm39) N956H probably benign Het
Prkdc C A 16: 15,526,792 (GRCm39) C1354* probably null Het
Ptpdc1 A G 13: 48,736,607 (GRCm39) V721A probably benign Het
Ptpro G A 6: 137,431,656 (GRCm39) V1172M probably damaging Het
Reln A T 5: 22,176,866 (GRCm39) N1933K probably benign Het
Rev1 A G 1: 38,093,945 (GRCm39) V1016A probably damaging Het
Ryr2 T G 13: 11,721,578 (GRCm39) K2618Q probably damaging Het
Spata31h1 T C 10: 82,130,986 (GRCm39) T675A probably benign Het
Tenm3 A T 8: 48,751,972 (GRCm39) M948K probably damaging Het
Tex48 G T 4: 63,530,105 (GRCm39) T38N probably damaging Het
Tom1l1 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 11: 90,540,648 (GRCm39) probably benign Het
Try10 G T 6: 41,333,559 (GRCm39) K101N probably benign Het
Ttc6 A G 12: 57,753,649 (GRCm39) Y1476C possibly damaging Het
Urb2 T C 8: 124,754,809 (GRCm39) V172A probably damaging Het
Zeb2 T A 2: 44,892,575 (GRCm39) E226V probably damaging Het
Zfp423 T A 8: 88,509,688 (GRCm39) I219F probably damaging Het
Zkscan1 A G 5: 138,091,666 (GRCm39) D133G probably damaging Het
Zscan4b G T 7: 10,635,856 (GRCm39) T157K possibly damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 32,824,496 (GRCm39) missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32,681,934 (GRCm39) missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 32,825,994 (GRCm39) missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 32,873,618 (GRCm39) missense probably benign 0.01
IGL01700:Wdfy4 APN 14 32,742,195 (GRCm39) splice site probably benign
IGL01931:Wdfy4 APN 14 32,877,710 (GRCm39) missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 32,855,673 (GRCm39) missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 32,798,437 (GRCm39) missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 32,815,257 (GRCm39) missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 32,871,523 (GRCm39) missense probably benign
IGL02468:Wdfy4 APN 14 32,688,389 (GRCm39) missense probably benign 0.01
IGL02512:Wdfy4 APN 14 32,764,448 (GRCm39) missense probably benign 0.01
IGL02597:Wdfy4 APN 14 32,812,818 (GRCm39) nonsense probably null
IGL02752:Wdfy4 APN 14 32,798,283 (GRCm39) missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 32,817,262 (GRCm39) missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32,693,707 (GRCm39) missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 32,831,607 (GRCm39) missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 32,798,241 (GRCm39) missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 32,862,608 (GRCm39) missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32,688,392 (GRCm39) missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 32,884,827 (GRCm39) missense probably benign 0.01
IGL03198:Wdfy4 APN 14 32,847,844 (GRCm39) missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32,699,124 (GRCm39) missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 32,790,861 (GRCm39) missense probably benign 0.01
IGL03398:Wdfy4 APN 14 32,769,247 (GRCm39) missense probably benign 0.14
dodgers UTSW 14 32,699,063 (GRCm39) nonsense probably null
Dollar UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
Giants UTSW 14 32,792,575 (GRCm39) nonsense probably null
gigantea UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
kings_canyon UTSW 14 32,831,476 (GRCm39) nonsense probably null
moro UTSW 14 32,686,583 (GRCm39) splice site probably null
popped UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
sequoia UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
Sherman UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
stretched UTSW 14 32,795,492 (GRCm39) nonsense probably null
watchtower UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R0014:Wdfy4 UTSW 14 32,829,130 (GRCm39) missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 32,884,708 (GRCm39) missense probably null 1.00
R0085:Wdfy4 UTSW 14 32,800,200 (GRCm39) missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 32,805,742 (GRCm39) missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 32,805,769 (GRCm39) splice site probably benign
R0496:Wdfy4 UTSW 14 32,862,695 (GRCm39) splice site probably benign
R0514:Wdfy4 UTSW 14 32,802,732 (GRCm39) missense probably benign 0.22
R0548:Wdfy4 UTSW 14 32,764,578 (GRCm39) missense probably benign
R0590:Wdfy4 UTSW 14 32,763,131 (GRCm39) missense probably benign 0.09
R0647:Wdfy4 UTSW 14 32,831,656 (GRCm39) missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 32,862,569 (GRCm39) missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R1024:Wdfy4 UTSW 14 32,801,923 (GRCm39) missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32,693,695 (GRCm39) missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32,693,729 (GRCm39) splice site probably null
R1415:Wdfy4 UTSW 14 32,763,137 (GRCm39) missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 32,830,645 (GRCm39) missense probably benign 0.14
R1483:Wdfy4 UTSW 14 32,822,923 (GRCm39) missense probably benign 0.41
R1490:Wdfy4 UTSW 14 32,874,495 (GRCm39) critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32,682,765 (GRCm39) missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32,681,918 (GRCm39) missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 32,795,542 (GRCm39) critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 32,817,962 (GRCm39) missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 32,825,940 (GRCm39) missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 32,855,301 (GRCm39) missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32,693,641 (GRCm39) missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 32,828,001 (GRCm39) missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 32,868,946 (GRCm39) missense probably benign 0.11
R2241:Wdfy4 UTSW 14 32,795,468 (GRCm39) missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 32,884,764 (GRCm39) missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R2889:Wdfy4 UTSW 14 32,831,476 (GRCm39) nonsense probably null
R3114:Wdfy4 UTSW 14 32,811,860 (GRCm39) missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3758:Wdfy4 UTSW 14 32,745,331 (GRCm39) missense probably benign 0.17
R3797:Wdfy4 UTSW 14 32,862,602 (GRCm39) missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 32,769,237 (GRCm39) missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32,688,352 (GRCm39) missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 32,824,637 (GRCm39) splice site probably benign
R4091:Wdfy4 UTSW 14 32,847,837 (GRCm39) missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 32,818,040 (GRCm39) missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 32,809,912 (GRCm39) missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 32,824,515 (GRCm39) missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32,711,893 (GRCm39) missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 32,831,505 (GRCm39) missense possibly damaging 0.88
R4718:Wdfy4 UTSW 14 32,867,273 (GRCm39) missense probably benign 0.03
R4862:Wdfy4 UTSW 14 32,822,860 (GRCm39) critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32,710,852 (GRCm39) nonsense probably null
R4894:Wdfy4 UTSW 14 32,877,717 (GRCm39) missense probably benign 0.03
R4929:Wdfy4 UTSW 14 32,769,213 (GRCm39) missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 32,750,970 (GRCm39) missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 32,822,897 (GRCm39) missense probably benign 0.02
R5020:Wdfy4 UTSW 14 32,801,892 (GRCm39) missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 32,874,627 (GRCm39) missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 32,769,232 (GRCm39) missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 32,800,300 (GRCm39) missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 32,812,823 (GRCm39) missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32,710,856 (GRCm39) missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32,681,959 (GRCm39) missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 32,742,268 (GRCm39) missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 32,873,689 (GRCm39) missense probably benign 0.17
R5591:Wdfy4 UTSW 14 32,829,087 (GRCm39) missense probably benign 0.09
R5598:Wdfy4 UTSW 14 32,855,454 (GRCm39) missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
R5890:Wdfy4 UTSW 14 32,824,534 (GRCm39) missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 32,855,317 (GRCm39) missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 32,827,968 (GRCm39) missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 32,868,947 (GRCm39) missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 32,805,596 (GRCm39) critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32,693,668 (GRCm39) missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 32,831,482 (GRCm39) missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 32,823,006 (GRCm39) nonsense probably null
R6370:Wdfy4 UTSW 14 32,790,807 (GRCm39) missense probably benign 0.16
R6390:Wdfy4 UTSW 14 32,826,051 (GRCm39) missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32,689,604 (GRCm39) missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 32,830,649 (GRCm39) missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 32,868,901 (GRCm39) missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 32,769,208 (GRCm39) missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 32,817,908 (GRCm39) missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 32,764,469 (GRCm39) missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32,681,923 (GRCm39) missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 32,821,074 (GRCm39) missense possibly damaging 0.68
R7024:Wdfy4 UTSW 14 32,686,583 (GRCm39) splice site probably null
R7101:Wdfy4 UTSW 14 32,682,777 (GRCm39) missense
R7114:Wdfy4 UTSW 14 32,693,531 (GRCm39) splice site probably null
R7139:Wdfy4 UTSW 14 32,873,535 (GRCm39) missense
R7255:Wdfy4 UTSW 14 32,696,239 (GRCm39) missense
R7324:Wdfy4 UTSW 14 32,769,271 (GRCm39) missense
R7379:Wdfy4 UTSW 14 32,873,566 (GRCm39) missense
R7399:Wdfy4 UTSW 14 32,790,863 (GRCm39) missense
R7408:Wdfy4 UTSW 14 32,800,264 (GRCm39) missense
R7410:Wdfy4 UTSW 14 32,696,191 (GRCm39) missense
R7411:Wdfy4 UTSW 14 32,828,088 (GRCm39) missense
R7412:Wdfy4 UTSW 14 32,871,541 (GRCm39) missense
R7445:Wdfy4 UTSW 14 32,792,575 (GRCm39) nonsense probably null
R7595:Wdfy4 UTSW 14 32,696,111 (GRCm39) critical splice donor site probably null
R7618:Wdfy4 UTSW 14 32,707,696 (GRCm39) missense
R7622:Wdfy4 UTSW 14 32,800,231 (GRCm39) missense
R7828:Wdfy4 UTSW 14 32,710,878 (GRCm39) missense possibly damaging 0.90
R7888:Wdfy4 UTSW 14 32,812,920 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,792,705 (GRCm39) missense
R7946:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7986:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R7990:Wdfy4 UTSW 14 32,819,752 (GRCm39) missense
R8001:Wdfy4 UTSW 14 32,695,492 (GRCm39) critical splice donor site probably null
R8010:Wdfy4 UTSW 14 32,693,584 (GRCm39) missense
R8015:Wdfy4 UTSW 14 32,829,704 (GRCm39) missense
R8032:Wdfy4 UTSW 14 32,751,043 (GRCm39) nonsense probably null
R8041:Wdfy4 UTSW 14 32,875,965 (GRCm39) critical splice donor site probably null
R8090:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8092:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8112:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8114:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8115:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8117:Wdfy4 UTSW 14 32,699,063 (GRCm39) nonsense probably null
R8118:Wdfy4 UTSW 14 32,826,072 (GRCm39) missense
R8140:Wdfy4 UTSW 14 32,864,317 (GRCm39) missense
R8155:Wdfy4 UTSW 14 32,884,776 (GRCm39) missense
R8163:Wdfy4 UTSW 14 32,873,545 (GRCm39) missense
R8293:Wdfy4 UTSW 14 32,696,218 (GRCm39) missense
R8325:Wdfy4 UTSW 14 32,689,444 (GRCm39) missense
R8353:Wdfy4 UTSW 14 32,695,581 (GRCm39) missense probably benign
R8370:Wdfy4 UTSW 14 32,815,208 (GRCm39) missense
R8437:Wdfy4 UTSW 14 32,798,332 (GRCm39) missense
R8497:Wdfy4 UTSW 14 32,688,356 (GRCm39) missense probably damaging 0.99
R8545:Wdfy4 UTSW 14 32,800,258 (GRCm39) missense probably benign 0.01
R8671:Wdfy4 UTSW 14 32,693,722 (GRCm39) splice site probably benign
R8708:Wdfy4 UTSW 14 32,689,489 (GRCm39) missense
R8747:Wdfy4 UTSW 14 32,874,611 (GRCm39) missense
R8794:Wdfy4 UTSW 14 32,869,049 (GRCm39) missense probably benign 0.03
R8846:Wdfy4 UTSW 14 32,867,105 (GRCm39) missense
R8880:Wdfy4 UTSW 14 32,795,492 (GRCm39) nonsense probably null
R9109:Wdfy4 UTSW 14 32,760,704 (GRCm39) splice site probably null
R9131:Wdfy4 UTSW 14 32,819,807 (GRCm39) missense
R9349:Wdfy4 UTSW 14 32,875,996 (GRCm39) missense
R9451:Wdfy4 UTSW 14 32,855,518 (GRCm39) missense
R9563:Wdfy4 UTSW 14 32,692,833 (GRCm39) missense
R9587:Wdfy4 UTSW 14 32,769,230 (GRCm39) nonsense probably null
R9599:Wdfy4 UTSW 14 32,855,428 (GRCm39) missense
R9670:Wdfy4 UTSW 14 32,769,219 (GRCm39) missense
R9718:Wdfy4 UTSW 14 32,847,893 (GRCm39) missense
R9742:Wdfy4 UTSW 14 32,809,987 (GRCm39) missense
X0028:Wdfy4 UTSW 14 32,802,593 (GRCm39) missense probably benign
X0053:Wdfy4 UTSW 14 32,884,899 (GRCm39) start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 32,829,575 (GRCm39) splice site probably null
Z1177:Wdfy4 UTSW 14 32,809,942 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GGCCACTGTTTGTCCATCATAG -3'
(R):5'- GGAAGTCTCTAGAAGCACAGTG -3'

Sequencing Primer
(F):5'- GCTCATATCCATGCAAAGTGG -3'
(R):5'- GTGCTGATCACGGCCAAATC -3'
Posted On 2022-03-25