Mutagenetix > Incidental Mutation

Incidental Mutation 'R9309:Itgb5'

705416

Institutional Source

Beutler Lab

Gene Symbol

Itgb5

Ensembl Gene

ENSMUSG00000022817

Gene Name

integrin beta 5

Synonyms

ESTM23, [b]-5, beta-5, beta5, [b]5, [b]5A, [b]5B

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9309 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33829665-33949338 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33920046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 509 (Y509H)

Ref Sequence

ENSEMBL: ENSMUSP00000069416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069345] [ENSMUST00000115028] [ENSMUST00000232262]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069345
AA Change: Y509H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000069416
Gene: ENSMUSG00000022817
AA Change: Y509H

Domain	Start	End	E-Value	Type
PSI	27	76	1.4e-7	SMART
INB	35	463	1.18e-284	SMART
VWA	137	372	5.95e-7	SMART
internal_repeat_1	492	549	3.16e-7	PROSPERO
EGF	554	586	1.95e1	SMART
Integrin_B_tail	635	719	1.56e-21	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115028
AA Change: Y509H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110680
Gene: ENSMUSG00000022817
AA Change: Y509H

Domain	Start	End	E-Value	Type
PSI	27	76	1.4e-7	SMART
INB	35	463	1.18e-284	SMART
VWA	137	372	5.95e-7	SMART
internal_repeat_1	492	549	3.16e-7	PROSPERO
EGF	554	586	1.95e1	SMART
Integrin_B_tail	635	719	1.56e-21	SMART
Integrin_b_cyt	743	790	5.97e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000232262
AA Change: Y196H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.5%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation do not appear to differ from normal in respect to development, reproduction, adenovirus infection, or wound healing. Mutant keratinocytes do show reduced migration on, and adhesion to, vitronectin in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310003L06Rik	C	A	5: 87,972,473	P363Q	probably damaging	Het
4932415D10Rik	T	C	10: 82,295,152	T675A	probably benign	Het
Acy3	C	T	19: 3,988,451	R193W	probably damaging	Het
Adam11	C	T	11: 102,772,884	T296M	probably damaging	Het
Ak9	T	C	10: 41,316,368		probably null	Het
Angpt2	A	T	8: 18,699,156	M315K	probably damaging	Het
Bpifa6	A	T	2: 153,992,287	D333V	probably benign	Het
Brsk1	T	C	7: 4,706,119		probably null	Het
Btn2a2	T	A	13: 23,478,811	H323L	probably damaging	Het
Cct8	G	A	16: 87,485,704	A442V	probably damaging	Het
Cdc20b	T	C	13: 113,079,938	V317A	probably damaging	Het
Cfh	A	T	1: 140,154,511	S211T	probably damaging	Het
Chd9	G	A	8: 91,006,691	R1396H	unknown	Het
Cobll1	A	G	2: 65,125,927	V329A	probably damaging	Het
Cope	T	C	8: 70,302,832	V9A	unknown	Het
Ctnnb1	A	T	9: 120,955,438	Y432F	probably benign	Het
Ercc6	T	A	14: 32,518,947	C143S	probably damaging	Het
H2-M10.1	T	C	17: 36,325,633	E93G	probably benign	Het
Haao	T	C	17: 83,838,841	E68G	probably damaging	Het
Hbq1b	G	A	11: 32,287,408		probably null	Het
Klc4	T	C	17: 46,636,624	N384S	probably damaging	Het
Lemd2	A	T	17: 27,192,962	V452E	probably damaging	Het
Lrit2	C	A	14: 37,071,891	A304E	probably benign	Het
Lrrc7	C	T	3: 158,209,724	W218*	probably null	Het
Mrpl39	C	T	16: 84,735,183	R12Q	unknown	Het
Msln	A	G	17: 25,751,174	V269A	possibly damaging	Het
Nf1	T	G	11: 79,468,769	M1411R	possibly damaging	Het
Obscn	C	T	11: 59,052,511	E4271K	probably damaging	Het
Olfr112	A	G	17: 37,564,158	L51P	probably damaging	Het
Olfr186	A	G	16: 59,027,823	F28S	probably damaging	Het
Olfr844	A	G	9: 19,319,148	I211V	probably benign	Het
Optc	G	T	1: 133,897,944	S334R	probably benign	Het
Patl1	C	A	19: 11,935,718	R542S	probably damaging	Het
Pcdhb19	T	C	18: 37,498,805	V551A	probably damaging	Het
Pkhd1l1	G	A	15: 44,536,893	M2144I	probably benign	Het
Polr3a	T	G	14: 24,459,999	N956H	probably benign	Het
Prkdc	C	A	16: 15,708,928	C1354*	probably null	Het
Ptpdc1	A	G	13: 48,583,131	V721A	probably benign	Het
Ptpro	G	A	6: 137,454,658	V1172M	probably damaging	Het
Reln	A	T	5: 21,971,868	N1933K	probably benign	Het
Rev1	A	G	1: 38,054,864	V1016A	probably damaging	Het
Ryr2	T	G	13: 11,706,692	K2618Q	probably damaging	Het
Tenm3	A	T	8: 48,298,937	M948K	probably damaging	Het
Tex48	G	T	4: 63,611,868	T38N	probably damaging	Het
Tom1l1	TTGCTGCTGCTGCTGCTG	TTGCTGCTGCTGCTG	11: 90,649,822		probably benign	Het
Try10	G	T	6: 41,356,625	K101N	probably benign	Het
Ttc6	A	G	12: 57,706,863	Y1476C	possibly damaging	Het
Urb2	T	C	8: 124,028,070	V172A	probably damaging	Het
Wdfy4	C	T	14: 33,095,356	G1544R		Het
Zeb2	T	A	2: 45,002,563	E226V	probably damaging	Het
Zfp423	T	A	8: 87,783,060	I219F	probably damaging	Het
Zkscan1	A	G	5: 138,093,404	D133G	probably damaging	Het
Zscan4b	G	T	7: 10,901,929	T157K	possibly damaging	Het

Other mutations in Itgb5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Itgb5	APN	16	33884975	missense	probably damaging	1.00
IGL01121:Itgb5	APN	16	33919989	missense	probably benign	0.00
IGL01620:Itgb5	APN	16	33919798	missense	probably damaging	1.00
IGL02332:Itgb5	APN	16	33920130	nonsense	probably null
IGL02869:Itgb5	APN	16	33844992	missense	possibly damaging	0.94
IGL02881:Itgb5	APN	16	33919905	missense	probably benign	0.00
IGL02941:Itgb5	APN	16	33944095	splice site	probably benign
IGL03216:Itgb5	APN	16	33902838	missense	probably benign	0.38
IGL03351:Itgb5	APN	16	33910552	missense	probably benign	0.00
PIT4812001:Itgb5	UTSW	16	33919987	missense	probably damaging	1.00
R0744:Itgb5	UTSW	16	33900583	missense	probably damaging	0.99
R0829:Itgb5	UTSW	16	33944201	missense	probably benign	0.29
R0836:Itgb5	UTSW	16	33900583	missense	probably damaging	0.99
R1387:Itgb5	UTSW	16	33900515	nonsense	probably null
R1703:Itgb5	UTSW	16	33910500	missense	probably benign	0.01
R1783:Itgb5	UTSW	16	33940562	missense	probably benign	0.13
R1826:Itgb5	UTSW	16	33865560	missense	possibly damaging	0.48
R1889:Itgb5	UTSW	16	33910469	missense	probably damaging	1.00
R2374:Itgb5	UTSW	16	33919798	missense	probably damaging	1.00
R4307:Itgb5	UTSW	16	33948732	missense	possibly damaging	0.80
R4355:Itgb5	UTSW	16	33844997	missense	probably damaging	0.98
R4796:Itgb5	UTSW	16	33885021	missense	possibly damaging	0.83
R4879:Itgb5	UTSW	16	33875978	missense	probably damaging	1.00
R6165:Itgb5	UTSW	16	33899242	missense	probably benign	0.01
R6584:Itgb5	UTSW	16	33885030	missense	probably damaging	1.00
R6617:Itgb5	UTSW	16	33946592	missense	probably benign	0.01
R6748:Itgb5	UTSW	16	33899297	missense	probably damaging	1.00
R6979:Itgb5	UTSW	16	33919986	missense	probably damaging	1.00
R7090:Itgb5	UTSW	16	33885094	missense	probably damaging	1.00
R7150:Itgb5	UTSW	16	33940643	missense	probably benign	0.03
R7403:Itgb5	UTSW	16	33902793	critical splice acceptor site	probably null
R7418:Itgb5	UTSW	16	33885094	missense	probably damaging	1.00
R7719:Itgb5	UTSW	16	33920116	missense	probably benign	0.01
R8309:Itgb5	UTSW	16	33865553	missense	probably benign	0.00
R8347:Itgb5	UTSW	16	33940678	missense	probably damaging	1.00
R8856:Itgb5	UTSW	16	33900592	missense	probably damaging	1.00
R9100:Itgb5	UTSW	16	33920181	missense	possibly damaging	0.91
R9194:Itgb5	UTSW	16	33900511	missense	probably damaging	1.00
R9343:Itgb5	UTSW	16	33910456	splice site	probably benign
R9629:Itgb5	UTSW	16	33875925	missense	probably damaging	1.00
R9683:Itgb5	UTSW	16	33919965	missense	probably damaging	0.97
R9710:Itgb5	UTSW	16	33865547	missense	probably benign	0.00
X0022:Itgb5	UTSW	16	33845050	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ACAGTCTGCAGGTGGAAGTC -3'
(R):5'- GTCTGGGTCCACATAATATCCAG -3'

Sequencing Primer
(F):5'- TGGAAGTCGCCTACAATTGC -3'
(R):5'- GGGTCCACATAATATCCAGGCCTG -3'

Posted On

2022-03-25