Incidental Mutation 'R0737:Txndc2'
ID 70543
Institutional Source Beutler Lab
Gene Symbol Txndc2
Ensembl Gene ENSMUSG00000050612
Gene Name thioredoxin domain containing 2 (spermatozoa)
Synonyms Sptrx-1
MMRRC Submission 038918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R0737 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 65637505-65642204 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 65639553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050236]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000050236
SMART Domains Protein: ENSMUSP00000054909
Gene: ENSMUSG00000050612

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
internal_repeat_1 70 232 1.7e-7 PROSPERO
internal_repeat_1 252 426 1.7e-7 PROSPERO
Pfam:Thioredoxin 447 548 3.6e-24 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene displays normal reproductive system phenotype while results in increased body size, increased serum phosphorus level and decreased serum IL-6 response to LPS challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 70,394,207 probably benign Het
4932429P05Rik A G X: 89,754,320 H586R probably benign Het
9130409I23Rik G A 1: 181,055,379 M235I probably benign Het
Aff4 T A 11: 53,410,953 L1043* probably null Het
Ankrd11 G T 8: 122,895,836 R426S probably damaging Het
Atm T A 9: 53,456,566 N2422I probably damaging Het
Bahcc1 C A 11: 120,272,841 P655Q probably damaging Het
Baz2a A G 10: 128,116,080 I556V possibly damaging Het
BC017643 C T 11: 121,227,242 probably null Het
Ccdc33 T C 9: 58,082,048 D114G probably damaging Het
Cdk5rap2 T C 4: 70,337,375 H424R probably benign Het
Cfap57 T C 4: 118,581,102 E864G possibly damaging Het
Cit T A 5: 115,946,919 S836R probably damaging Het
Clip4 C T 17: 71,837,699 Q95* probably null Het
Col17a1 C T 19: 47,669,433 G433S possibly damaging Het
Col6a3 A G 1: 90,828,298 F90L probably damaging Het
Dnah9 T C 11: 66,107,898 H1108R probably damaging Het
Elac1 A T 18: 73,739,039 M295K probably damaging Het
Epas1 G T 17: 86,829,456 G816C possibly damaging Het
Ermap C A 4: 119,178,510 C427F probably damaging Het
Fbxo44 T C 4: 148,158,809 probably benign Het
Fmo4 T A 1: 162,808,392 K14* probably null Het
Gadl1 G A 9: 116,073,987 M461I probably damaging Het
Garnl3 T A 2: 32,990,642 I868F probably damaging Het
Gm6614 G T 6: 142,003,428 A74E possibly damaging Het
Gm7168 A G 17: 13,948,983 D204G probably damaging Het
Hs6st3 T C 14: 119,869,383 F401S possibly damaging Het
Kcnmb1 A T 11: 33,964,701 M1L probably benign Het
Krt35 T C 11: 100,093,794 T292A probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lamb2 T A 9: 108,483,794 W572R probably benign Het
Letmd1 A G 15: 100,469,821 T87A probably damaging Het
Lrp2 A G 2: 69,448,169 Y3947H probably damaging Het
Mocos T C 18: 24,688,987 F685L probably damaging Het
Nsun6 A T 2: 14,996,474 F424I probably damaging Het
Nup88 A G 11: 70,969,950 M1T probably null Het
Olfr1209 T C 2: 88,910,273 N40S probably damaging Het
Olfr1339 C T 4: 118,735,224 R232C probably benign Het
Olfr297 C T 7: 86,526,987 P77S probably damaging Het
Pcdhb12 T A 18: 37,437,709 V636D probably damaging Het
Pclo C A 5: 14,515,439 A73E probably damaging Het
Pdlim7 A T 13: 55,504,880 probably null Het
Phldb1 G A 9: 44,699,636 P67S possibly damaging Het
Ppp2r2b T C 18: 43,059,192 T17A probably benign Het
Rab11fip4 T C 11: 79,683,502 V241A probably benign Het
Slc41a1 T C 1: 131,840,952 L216P probably damaging Het
Smg6 T A 11: 75,159,836 D1352E probably damaging Het
Tbc1d9 A T 8: 83,259,313 I816F probably damaging Het
Tex264 T C 9: 106,659,299 T220A probably benign Het
Tmco6 G A 18: 36,741,776 V439I probably damaging Het
Tmem64 A G 4: 15,266,717 I256V probably damaging Het
Tnks1bp1 A G 2: 85,052,536 S236G possibly damaging Het
Tsc1 A G 2: 28,670,930 T267A possibly damaging Het
Vmn2r94 G A 17: 18,277,433 Q26* probably null Het
Zan T C 5: 137,389,249 D4900G unknown Het
Zkscan3 T C 13: 21,388,596 T122A probably benign Het
Other mutations in Txndc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txndc2 APN 17 65638574 missense probably benign 0.41
IGL00985:Txndc2 APN 17 65638549 missense possibly damaging 0.95
IGL01304:Txndc2 APN 17 65638453 missense possibly damaging 0.79
IGL01525:Txndc2 APN 17 65638913 missense possibly damaging 0.84
IGL02472:Txndc2 APN 17 65637976 missense possibly damaging 0.86
IGL02559:Txndc2 APN 17 65639590 missense possibly damaging 0.91
IGL02802:Txndc2 UTSW 17 65639606 missense possibly damaging 0.93
R0508:Txndc2 UTSW 17 65637953 missense probably benign 0.01
R1525:Txndc2 UTSW 17 65638315 missense probably damaging 1.00
R1569:Txndc2 UTSW 17 65638926 missense probably benign 0.44
R1746:Txndc2 UTSW 17 65638135 missense probably damaging 1.00
R4063:Txndc2 UTSW 17 65638084 missense possibly damaging 0.86
R4971:Txndc2 UTSW 17 65638854 missense probably damaging 0.96
R4983:Txndc2 UTSW 17 65638060 missense probably benign 0.01
R6177:Txndc2 UTSW 17 65638471 missense probably benign 0.44
R6762:Txndc2 UTSW 17 65638972 missense probably damaging 0.99
R6915:Txndc2 UTSW 17 65638291 missense probably benign
R7574:Txndc2 UTSW 17 65638625 missense possibly damaging 0.86
R7775:Txndc2 UTSW 17 65638243 missense probably benign 0.01
R9294:Txndc2 UTSW 17 65639024 missense unknown
R9359:Txndc2 UTSW 17 65637997 missense probably damaging 0.99
R9403:Txndc2 UTSW 17 65637997 missense probably damaging 0.99
R9669:Txndc2 UTSW 17 65638588 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAGGCATCTGATGAATGGTGTACAG -3'
(R):5'- GCTGCCTCAAAGCTCTCAAAGTCC -3'

Sequencing Primer
(F):5'- CTGATGAATGGTGTACAGATCTAAG -3'
(R):5'- AAGCTCTCAAAGTCCACTGTTG -3'
Posted On 2013-09-30