Incidental Mutation 'R0737:Txndc2'
ID 70543
Institutional Source Beutler Lab
Gene Symbol Txndc2
Ensembl Gene ENSMUSG00000050612
Gene Name thioredoxin domain containing 2 (spermatozoa)
Synonyms Sptrx-1
MMRRC Submission 038918-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.216) question?
Stock # R0737 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 65944502-65949163 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 65946548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000054909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050236]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000050236
SMART Domains Protein: ENSMUSP00000054909
Gene: ENSMUSG00000050612

DomainStartEndE-ValueType
low complexity region 10 19 N/A INTRINSIC
internal_repeat_1 70 232 1.7e-7 PROSPERO
internal_repeat_1 252 426 1.7e-7 PROSPERO
Pfam:Thioredoxin 447 548 3.6e-24 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene displays normal reproductive system phenotype while results in increased body size, increased serum phosphorus level and decreased serum IL-6 response to LPS challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik T A X: 69,437,813 (GRCm39) probably benign Het
Aff4 T A 11: 53,301,780 (GRCm39) L1043* probably null Het
Ankrd11 G T 8: 123,622,575 (GRCm39) R426S probably damaging Het
Atm T A 9: 53,367,866 (GRCm39) N2422I probably damaging Het
Bahcc1 C A 11: 120,163,667 (GRCm39) P655Q probably damaging Het
Baz2a A G 10: 127,951,949 (GRCm39) I556V possibly damaging Het
Ccdc33 T C 9: 57,989,331 (GRCm39) D114G probably damaging Het
Cdk5rap2 T C 4: 70,255,612 (GRCm39) H424R probably benign Het
Cfap57 T C 4: 118,438,299 (GRCm39) E864G possibly damaging Het
Cit T A 5: 116,084,978 (GRCm39) S836R probably damaging Het
Clip4 C T 17: 72,144,694 (GRCm39) Q95* probably null Het
Col17a1 C T 19: 47,657,872 (GRCm39) G433S possibly damaging Het
Col6a3 A G 1: 90,756,020 (GRCm39) F90L probably damaging Het
Cybc1 C T 11: 121,118,068 (GRCm39) probably null Het
Degs1l G A 1: 180,882,944 (GRCm39) M235I probably benign Het
Dnah9 T C 11: 65,998,724 (GRCm39) H1108R probably damaging Het
Elac1 A T 18: 73,872,110 (GRCm39) M295K probably damaging Het
Epas1 G T 17: 87,136,884 (GRCm39) G816C possibly damaging Het
Ermap C A 4: 119,035,707 (GRCm39) C427F probably damaging Het
Fbxo44 T C 4: 148,243,266 (GRCm39) probably benign Het
Fmo4 T A 1: 162,635,961 (GRCm39) K14* probably null Het
Gadl1 G A 9: 115,903,055 (GRCm39) M461I probably damaging Het
Garnl3 T A 2: 32,880,654 (GRCm39) I868F probably damaging Het
Gm7168 A G 17: 14,169,245 (GRCm39) D204G probably damaging Het
Hs6st3 T C 14: 120,106,795 (GRCm39) F401S possibly damaging Het
Kcnmb1 A T 11: 33,914,701 (GRCm39) M1L probably benign Het
Krt35 T C 11: 99,984,620 (GRCm39) T292A probably benign Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lamb2 T A 9: 108,360,993 (GRCm39) W572R probably benign Het
Letmd1 A G 15: 100,367,702 (GRCm39) T87A probably damaging Het
Lrp2 A G 2: 69,278,513 (GRCm39) Y3947H probably damaging Het
Mocos T C 18: 24,822,044 (GRCm39) F685L probably damaging Het
Nsun6 A T 2: 15,001,285 (GRCm39) F424I probably damaging Het
Nup88 A G 11: 70,860,776 (GRCm39) M1T probably null Het
Or13p5 C T 4: 118,592,421 (GRCm39) R232C probably benign Het
Or14c45 C T 7: 86,176,195 (GRCm39) P77S probably damaging Het
Or4c29 T C 2: 88,740,617 (GRCm39) N40S probably damaging Het
Pcdhb12 T A 18: 37,570,762 (GRCm39) V636D probably damaging Het
Pclo C A 5: 14,565,453 (GRCm39) A73E probably damaging Het
Pdlim7 A T 13: 55,652,693 (GRCm39) probably null Het
Phldb1 G A 9: 44,610,933 (GRCm39) P67S possibly damaging Het
Ppp2r2b T C 18: 43,192,257 (GRCm39) T17A probably benign Het
Ppp4r3c2 A G X: 88,797,926 (GRCm39) H586R probably benign Het
Rab11fip4 T C 11: 79,574,328 (GRCm39) V241A probably benign Het
Slc41a1 T C 1: 131,768,690 (GRCm39) L216P probably damaging Het
Slco1a8 G T 6: 141,949,154 (GRCm39) A74E possibly damaging Het
Smg6 T A 11: 75,050,662 (GRCm39) D1352E probably damaging Het
Tbc1d9 A T 8: 83,985,942 (GRCm39) I816F probably damaging Het
Tex264 T C 9: 106,536,498 (GRCm39) T220A probably benign Het
Tmco6 G A 18: 36,874,829 (GRCm39) V439I probably damaging Het
Tmem64 A G 4: 15,266,717 (GRCm39) I256V probably damaging Het
Tnks1bp1 A G 2: 84,882,880 (GRCm39) S236G possibly damaging Het
Tsc1 A G 2: 28,560,942 (GRCm39) T267A possibly damaging Het
Vmn2r94 G A 17: 18,497,695 (GRCm39) Q26* probably null Het
Zan T C 5: 137,387,511 (GRCm39) D4900G unknown Het
Zkscan3 T C 13: 21,572,766 (GRCm39) T122A probably benign Het
Other mutations in Txndc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Txndc2 APN 17 65,945,569 (GRCm39) missense probably benign 0.41
IGL00985:Txndc2 APN 17 65,945,544 (GRCm39) missense possibly damaging 0.95
IGL01304:Txndc2 APN 17 65,945,448 (GRCm39) missense possibly damaging 0.79
IGL01525:Txndc2 APN 17 65,945,908 (GRCm39) missense possibly damaging 0.84
IGL02472:Txndc2 APN 17 65,944,971 (GRCm39) missense possibly damaging 0.86
IGL02559:Txndc2 APN 17 65,946,585 (GRCm39) missense possibly damaging 0.91
IGL02802:Txndc2 UTSW 17 65,946,601 (GRCm39) missense possibly damaging 0.93
R0508:Txndc2 UTSW 17 65,944,948 (GRCm39) missense probably benign 0.01
R1525:Txndc2 UTSW 17 65,945,310 (GRCm39) missense probably damaging 1.00
R1569:Txndc2 UTSW 17 65,945,921 (GRCm39) missense probably benign 0.44
R1746:Txndc2 UTSW 17 65,945,130 (GRCm39) missense probably damaging 1.00
R4063:Txndc2 UTSW 17 65,945,079 (GRCm39) missense possibly damaging 0.86
R4971:Txndc2 UTSW 17 65,945,849 (GRCm39) missense probably damaging 0.96
R4983:Txndc2 UTSW 17 65,945,055 (GRCm39) missense probably benign 0.01
R6177:Txndc2 UTSW 17 65,945,466 (GRCm39) missense probably benign 0.44
R6762:Txndc2 UTSW 17 65,945,967 (GRCm39) missense probably damaging 0.99
R6915:Txndc2 UTSW 17 65,945,286 (GRCm39) missense probably benign
R7574:Txndc2 UTSW 17 65,945,620 (GRCm39) missense possibly damaging 0.86
R7775:Txndc2 UTSW 17 65,945,238 (GRCm39) missense probably benign 0.01
R9294:Txndc2 UTSW 17 65,946,019 (GRCm39) missense unknown
R9359:Txndc2 UTSW 17 65,944,992 (GRCm39) missense probably damaging 0.99
R9403:Txndc2 UTSW 17 65,944,992 (GRCm39) missense probably damaging 0.99
R9669:Txndc2 UTSW 17 65,945,583 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAGGCATCTGATGAATGGTGTACAG -3'
(R):5'- GCTGCCTCAAAGCTCTCAAAGTCC -3'

Sequencing Primer
(F):5'- CTGATGAATGGTGTACAGATCTAAG -3'
(R):5'- AAGCTCTCAAAGTCCACTGTTG -3'
Posted On 2013-09-30