Incidental Mutation 'R9310:Suco'
ID 705434
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene Name SUN domain containing ossification factor
Synonyms AI848100, osteopotentia, Opt
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.557) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 161643683-161704251 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 161684427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 231 (K231R)
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048377
AA Change: K231R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297
AA Change: K231R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000192570
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 117,698,859 (GRCm39) I83V possibly damaging Het
Abcf1 G A 17: 36,272,621 (GRCm39) A288V probably null Het
Acer1 A T 17: 57,262,598 (GRCm39) V184D probably damaging Het
Apoh T C 11: 108,298,307 (GRCm39) probably null Het
Arid1a T C 4: 133,413,625 (GRCm39) Y959C unknown Het
Asb3 A T 11: 30,978,962 (GRCm39) H84L probably benign Het
Atxn1 A C 13: 45,721,494 (GRCm39) Y134D probably damaging Het
Btbd1 T C 7: 81,478,985 (GRCm39) Y52C probably damaging Het
Cabp2 A G 19: 4,136,464 (GRCm39) D170G probably damaging Het
Cacna1a C A 8: 85,263,046 (GRCm39) A407E probably damaging Het
Cacna2d4 T A 6: 119,248,914 (GRCm39) probably null Het
Cc2d2a T C 5: 43,852,488 (GRCm39) F404S probably damaging Het
Cdh20 T C 1: 104,875,061 (GRCm39) M281T probably damaging Het
Cfap54 A T 10: 92,798,177 (GRCm39) M1694K unknown Het
Chd6 G T 2: 160,881,181 (GRCm39) T261K probably damaging Het
Cnksr1 T C 4: 133,956,330 (GRCm39) S585G probably damaging Het
Cntnap2 A T 6: 45,978,281 (GRCm39) Y312F probably damaging Het
Coa7 T A 4: 108,195,510 (GRCm39) Y146* probably null Het
Col28a1 T C 6: 8,175,414 (GRCm39) K145E unknown Het
Coq8b T A 7: 26,941,486 (GRCm39) I221N probably damaging Het
Cpd A T 11: 76,705,607 (GRCm39) L375* probably null Het
Dnah5 T C 15: 28,448,579 (GRCm39) F4214S probably damaging Het
Dnai3 C T 3: 145,802,895 (GRCm39) probably null Het
Dock2 A G 11: 34,244,139 (GRCm39) F1067S possibly damaging Het
Dpp6 G A 5: 27,836,439 (GRCm39) A310T probably damaging Het
Dpp6 C A 5: 27,930,642 (GRCm39) L825I probably benign Het
Efcab5 A G 11: 77,004,531 (GRCm39) V929A probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Espl1 G A 15: 102,205,285 (GRCm39) probably null Het
Firrm A G 1: 163,792,089 (GRCm39) C610R probably damaging Het
Gm4847 T C 1: 166,460,281 (GRCm39) R402G probably benign Het
Grid1 T C 14: 34,748,762 (GRCm39) L194S probably damaging Het
Heatr1 A T 13: 12,453,491 (GRCm39) H2122L probably benign Het
Il17b T A 18: 61,825,334 (GRCm39) C123* probably null Het
Il17rc T C 6: 113,451,210 (GRCm39) L181P probably damaging Het
Inpp5e T A 2: 26,287,940 (GRCm39) I619L probably benign Het
Itgax C A 7: 127,741,432 (GRCm39) Y814* probably null Het
Marcks C T 10: 37,012,487 (GRCm39) E183K unknown Het
Mefv T C 16: 3,533,252 (GRCm39) T340A probably benign Het
Mical2 A G 7: 111,950,920 (GRCm39) K958R probably benign Het
Mrtfb T A 16: 13,218,954 (GRCm39) D533E probably benign Het
Mtor T A 4: 148,553,834 (GRCm39) L811Q probably benign Het
Myh4 A G 11: 67,145,570 (GRCm39) Y1351C probably damaging Het
Neb T C 2: 52,153,708 (GRCm39) M2406V probably benign Het
Nebl T C 2: 17,353,678 (GRCm39) T214A probably benign Het
Nlrx1 A T 9: 44,164,705 (GRCm39) I913N probably damaging Het
Npr2 G T 4: 43,632,404 (GRCm39) A74S probably benign Het
Or4c115 T A 2: 88,928,257 (GRCm39) S5C probably damaging Het
Or6b6 C A 7: 106,570,678 (GRCm39) C291F probably damaging Het
Or6c88 T A 10: 129,406,687 (GRCm39) N54K probably benign Het
Pard3b G T 1: 62,205,528 (GRCm39) V441F probably damaging Het
Pcsk1 G A 13: 75,238,191 (GRCm39) R4K probably benign Het
Pisd G T 5: 32,894,784 (GRCm39) N337K possibly damaging Het
Pml T C 9: 58,156,945 (GRCm39) K10R probably benign Het
Prkci T C 3: 31,083,664 (GRCm39) W132R probably damaging Het
Prrc2a A T 17: 35,374,975 (GRCm39) M1225K probably benign Het
Prss23 T C 7: 89,159,142 (GRCm39) D309G probably damaging Het
Pxdn G A 12: 30,052,051 (GRCm39) G743S probably damaging Het
Rab29 A T 1: 131,799,860 (GRCm39) E145V probably damaging Het
Rasef C T 4: 73,653,956 (GRCm39) probably null Het
Rcbtb1 T G 14: 59,472,699 (GRCm39) I496S probably benign Het
Rcor1 T C 12: 111,066,393 (GRCm39) Y228H Het
Reep5 C T 18: 34,490,222 (GRCm39) V92I probably damaging Het
Rfx3 T C 19: 27,827,329 (GRCm39) S86G probably benign Het
Rptn T A 3: 93,304,384 (GRCm39) D572E probably benign Het
Rsl1 A T 13: 67,324,510 (GRCm39) probably null Het
Sbf2 T C 7: 109,914,292 (GRCm39) E1630G possibly damaging Het
Sele G A 1: 163,876,975 (GRCm39) V84I probably benign Het
Serpina1b T C 12: 103,698,756 (GRCm39) D31G probably benign Het
Serpina3c T C 12: 104,115,813 (GRCm39) I244V probably benign Het
Serpinb6e A G 13: 34,017,204 (GRCm39) V272A probably benign Het
Serpinb9b A G 13: 33,219,523 (GRCm39) D150G probably benign Het
Sgpp1 T C 12: 75,769,374 (GRCm39) T265A probably benign Het
Slc9a1 T A 4: 133,143,681 (GRCm39) M389K probably damaging Het
Slco3a1 A T 7: 74,204,236 (GRCm39) C35S probably damaging Het
Slco6d1 T A 1: 98,427,619 (GRCm39) V650E possibly damaging Het
Slit2 T C 5: 48,349,568 (GRCm39) V274A possibly damaging Het
Snd1 A G 6: 28,795,936 (GRCm39) E593G probably null Het
Spata2l C T 8: 123,960,873 (GRCm39) V139M probably benign Het
Tenm3 C A 8: 49,008,935 (GRCm39) probably benign Het
Tg T C 15: 66,699,118 (GRCm39) S2415P possibly damaging Het
Traf6 C A 2: 101,527,072 (GRCm39) A274D possibly damaging Het
Usp14 A G 18: 9,996,239 (GRCm39) I447T possibly damaging Het
Usp32 G A 11: 84,942,028 (GRCm39) L355F probably benign Het
Vcpip1 T C 1: 9,817,927 (GRCm39) N152S possibly damaging Het
Vgf A G 5: 137,061,110 (GRCm39) Q424R probably benign Het
Vmn2r84 A T 10: 130,227,993 (GRCm39) M81K possibly damaging Het
Washc5 G A 15: 59,218,067 (GRCm39) A732V possibly damaging Het
Xrcc3 T G 12: 111,771,485 (GRCm39) D213A probably damaging Het
Zeb2 T C 2: 44,886,988 (GRCm39) T690A probably benign Het
Zfat G A 15: 67,956,250 (GRCm39) S1212L probably damaging Het
Zfp623 C T 15: 75,819,949 (GRCm39) L302F probably damaging Het
Zfp799 A C 17: 33,039,733 (GRCm39) C178G possibly damaging Het
Zfy1 T C Y: 727,634 (GRCm39) E348G unknown Het
Zhx3 A G 2: 160,621,393 (GRCm39) W925R possibly damaging Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161,661,689 (GRCm39) missense probably damaging 1.00
IGL01688:Suco APN 1 161,691,480 (GRCm39) splice site probably null
IGL01794:Suco APN 1 161,655,294 (GRCm39) missense probably benign 0.01
IGL01891:Suco APN 1 161,666,371 (GRCm39) missense probably damaging 1.00
IGL02028:Suco APN 1 161,684,428 (GRCm39) missense possibly damaging 0.95
IGL02102:Suco APN 1 161,655,274 (GRCm39) missense probably damaging 1.00
IGL02351:Suco APN 1 161,646,195 (GRCm39) missense probably benign 0.35
IGL02358:Suco APN 1 161,646,195 (GRCm39) missense probably benign 0.35
IGL02392:Suco APN 1 161,662,136 (GRCm39) missense probably benign 0.11
IGL02638:Suco APN 1 161,655,256 (GRCm39) missense probably damaging 1.00
IGL02650:Suco APN 1 161,676,322 (GRCm39) splice site probably benign
IGL03106:Suco APN 1 161,662,049 (GRCm39) missense possibly damaging 0.91
IGL03189:Suco APN 1 161,684,906 (GRCm39) unclassified probably benign
IGL03328:Suco APN 1 161,647,990 (GRCm39) missense probably damaging 0.99
girth UTSW 1 161,655,809 (GRCm39) missense possibly damaging 0.86
pleasingly UTSW 1 161,661,977 (GRCm39) missense possibly damaging 0.65
3-1:Suco UTSW 1 161,649,600 (GRCm39) intron probably benign
H8562:Suco UTSW 1 161,680,420 (GRCm39) missense probably damaging 1.00
H8786:Suco UTSW 1 161,680,420 (GRCm39) missense probably damaging 1.00
R0023:Suco UTSW 1 161,673,154 (GRCm39) splice site probably null
R0023:Suco UTSW 1 161,673,154 (GRCm39) splice site probably null
R0179:Suco UTSW 1 161,703,874 (GRCm39) splice site probably benign
R0299:Suco UTSW 1 161,681,379 (GRCm39) missense probably benign
R0418:Suco UTSW 1 161,662,419 (GRCm39) missense probably benign 0.11
R0481:Suco UTSW 1 161,689,882 (GRCm39) unclassified probably benign
R0610:Suco UTSW 1 161,691,601 (GRCm39) splice site probably benign
R0610:Suco UTSW 1 161,687,072 (GRCm39) missense probably benign
R0634:Suco UTSW 1 161,666,373 (GRCm39) missense possibly damaging 0.77
R0645:Suco UTSW 1 161,661,683 (GRCm39) missense probably damaging 1.00
R1276:Suco UTSW 1 161,685,025 (GRCm39) missense probably benign 0.10
R1720:Suco UTSW 1 161,661,623 (GRCm39) missense probably damaging 1.00
R1739:Suco UTSW 1 161,655,224 (GRCm39) critical splice donor site probably null
R1763:Suco UTSW 1 161,662,518 (GRCm39) missense possibly damaging 0.80
R1835:Suco UTSW 1 161,687,069 (GRCm39) nonsense probably null
R1988:Suco UTSW 1 161,646,380 (GRCm39) critical splice acceptor site probably null
R2939:Suco UTSW 1 161,676,220 (GRCm39) missense probably damaging 1.00
R3773:Suco UTSW 1 161,671,565 (GRCm39) splice site probably null
R3882:Suco UTSW 1 161,662,313 (GRCm39) missense probably benign 0.33
R4193:Suco UTSW 1 161,691,528 (GRCm39) missense probably benign 0.32
R4367:Suco UTSW 1 161,674,799 (GRCm39) missense probably damaging 1.00
R4397:Suco UTSW 1 161,672,421 (GRCm39) missense probably damaging 1.00
R4846:Suco UTSW 1 161,661,977 (GRCm39) missense possibly damaging 0.65
R4851:Suco UTSW 1 161,661,761 (GRCm39) missense probably damaging 1.00
R5224:Suco UTSW 1 161,662,274 (GRCm39) missense probably benign 0.06
R5329:Suco UTSW 1 161,660,999 (GRCm39) missense probably damaging 0.99
R6133:Suco UTSW 1 161,662,752 (GRCm39) nonsense probably null
R6632:Suco UTSW 1 161,655,809 (GRCm39) missense possibly damaging 0.86
R6643:Suco UTSW 1 161,687,001 (GRCm39) missense possibly damaging 0.71
R7378:Suco UTSW 1 161,689,780 (GRCm39) missense possibly damaging 0.76
R7405:Suco UTSW 1 161,655,783 (GRCm39) missense possibly damaging 0.65
R7509:Suco UTSW 1 161,672,903 (GRCm39) missense probably damaging 1.00
R7838:Suco UTSW 1 161,656,890 (GRCm39) missense probably benign 0.07
R7867:Suco UTSW 1 161,665,365 (GRCm39) missense possibly damaging 0.77
R7895:Suco UTSW 1 161,672,937 (GRCm39) splice site probably null
R8440:Suco UTSW 1 161,679,907 (GRCm39) missense probably damaging 1.00
R8453:Suco UTSW 1 161,650,586 (GRCm39) intron probably benign
R8781:Suco UTSW 1 161,645,951 (GRCm39) missense probably damaging 1.00
R8798:Suco UTSW 1 161,648,004 (GRCm39) missense probably damaging 1.00
R9292:Suco UTSW 1 161,671,574 (GRCm39) missense probably damaging 1.00
R9380:Suco UTSW 1 161,646,074 (GRCm39) missense possibly damaging 0.61
R9411:Suco UTSW 1 161,666,356 (GRCm39) missense probably damaging 0.99
R9542:Suco UTSW 1 161,661,668 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGACGCAGAGTACATCAG -3'
(R):5'- TGTTTGGTGCAAGCTTCATTCC -3'

Sequencing Primer
(F):5'- GACGCAGAGTACATCAGTTTTATGAC -3'
(R):5'- TGCAAGCTTCATTCCAATTTTATTAC -3'
Posted On 2022-03-25