Incidental Mutation 'R9310:Sele'
ID 705436
Institutional Source Beutler Lab
Gene Symbol Sele
Ensembl Gene ENSMUSG00000026582
Gene Name selectin, endothelial cell
Synonyms CD62E, E-selectin, Elam
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 164048234-164057677 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 164049406 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 84 (V84I)
Ref Sequence ENSEMBL: ENSMUSP00000027874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027874]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027874
AA Change: V84I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: V84I

DomainStartEndE-ValueType
CLECT 21 146 1.45e-21 SMART
EGF 149 182 2.83e-5 SMART
CCP 187 245 1.49e-9 SMART
CCP 250 307 5.43e-12 SMART
CCP 312 370 1.82e-13 SMART
CCP 375 433 1.36e-12 SMART
CCP 438 496 6e-14 SMART
CCP 501 555 1.39e-9 SMART
transmembrane domain 565 587 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Sele
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Sele APN 1 164051834 missense probably damaging 1.00
IGL02097:Sele APN 1 164053093 missense probably benign 0.02
IGL02243:Sele APN 1 164052968 missense probably benign 0.01
IGL02688:Sele APN 1 164050130 missense probably damaging 1.00
IGL03022:Sele APN 1 164054679 missense probably benign 0.01
R0433:Sele UTSW 1 164049244 missense possibly damaging 0.74
R0487:Sele UTSW 1 164053615 nonsense probably null
R0678:Sele UTSW 1 164054729 critical splice donor site probably null
R1295:Sele UTSW 1 164050810 missense probably damaging 1.00
R1296:Sele UTSW 1 164050810 missense probably damaging 1.00
R1532:Sele UTSW 1 164053851 missense probably benign 0.29
R1730:Sele UTSW 1 164054623 missense probably benign
R2102:Sele UTSW 1 164053826 missense probably damaging 1.00
R2384:Sele UTSW 1 164050775 missense probably benign 0.00
R3001:Sele UTSW 1 164053571 missense probably damaging 1.00
R3002:Sele UTSW 1 164053571 missense probably damaging 1.00
R5851:Sele UTSW 1 164049574 missense probably benign 0.06
R6164:Sele UTSW 1 164051817 splice site probably null
R6239:Sele UTSW 1 164050808 missense probably damaging 0.98
R6406:Sele UTSW 1 164050743 missense probably damaging 1.00
R6411:Sele UTSW 1 164049415 missense probably benign 0.03
R6731:Sele UTSW 1 164053673 missense probably damaging 1.00
R6851:Sele UTSW 1 164053952 missense probably damaging 1.00
R7291:Sele UTSW 1 164053868 missense possibly damaging 0.89
R7328:Sele UTSW 1 164049275 missense probably benign 0.23
R7366:Sele UTSW 1 164048719 missense probably benign 0.00
R7393:Sele UTSW 1 164053923 missense probably benign 0.05
R7431:Sele UTSW 1 164051620 missense probably damaging 0.99
R7603:Sele UTSW 1 164049515 missense probably damaging 1.00
R7803:Sele UTSW 1 164050694 missense possibly damaging 0.88
R7807:Sele UTSW 1 164053893 missense probably benign 0.05
R8323:Sele UTSW 1 164051638 missense possibly damaging 0.59
R9018:Sele UTSW 1 164053679 missense probably damaging 1.00
X0005:Sele UTSW 1 164049343 missense probably damaging 1.00
X0021:Sele UTSW 1 164053611 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGCTTGGTACTACAATGCCTC -3'
(R):5'- TCAATCTGTCAGGCTGCCTC -3'

Sequencing Primer
(F):5'- TGGTACTACAATGCCTCCAGTGAG -3'
(R):5'- GCAGAAACTTCATACCTGTGTAGC -3'
Posted On 2022-03-25