Incidental Mutation 'R9310:Nebl'
ID 705438
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Name nebulette
Synonyms Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 17343909-17731464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17348867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 214 (T214A)
Ref Sequence ENSEMBL: ENSMUSP00000028080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270]
AlphaFold Q0II04
Predicted Effect probably benign
Transcript: ENSMUST00000028080
AA Change: T214A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702
AA Change: T214A

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124270
AA Change: T958A

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: T958A

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
BB008:Nebl UTSW 2 17376622 critical splice donor site probably null
BB018:Nebl UTSW 2 17376622 critical splice donor site probably null
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2183:Nebl UTSW 2 17404216 missense probably damaging 0.99
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 splice site probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
R7931:Nebl UTSW 2 17376622 critical splice donor site probably null
R8007:Nebl UTSW 2 17370489 missense
R8048:Nebl UTSW 2 17424522 missense probably benign 0.12
R8118:Nebl UTSW 2 17379820 missense possibly damaging 0.48
R8317:Nebl UTSW 2 17350757 missense possibly damaging 0.71
R8349:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8360:Nebl UTSW 2 17460487 missense probably benign 0.04
R8392:Nebl UTSW 2 17452552 missense probably benign 0.36
R8449:Nebl UTSW 2 17413782 missense probably damaging 0.98
R8537:Nebl UTSW 2 17350709 missense probably benign 0.02
R8778:Nebl UTSW 2 17404267 missense probably damaging 1.00
R8893:Nebl UTSW 2 17730860 start codon destroyed probably null 1.00
R8894:Nebl UTSW 2 17375225 missense probably benign 0.01
R8906:Nebl UTSW 2 17378117 missense probably benign 0.18
R8929:Nebl UTSW 2 17393180 nonsense probably null
R9054:Nebl UTSW 2 17411096 missense possibly damaging 0.72
R9119:Nebl UTSW 2 17400559 missense probably damaging 0.96
R9211:Nebl UTSW 2 17388690 critical splice donor site probably null
R9225:Nebl UTSW 2 17400511 missense possibly damaging 0.70
R9474:Nebl UTSW 2 17369610 nonsense probably null
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATAATAAAGCTCGAAGGGC -3'
(R):5'- AGGTACTGTGCTATCTTTCTGGAC -3'

Sequencing Primer
(F):5'- GGGCAAGGAGAAAGAATTAATTCAC -3'
(R):5'- GGACCCTTGCTTTGACCTTAAATATG -3'
Posted On 2022-03-25