Mutagenetix > Incidental Mutation

Incidental Mutation 'R9310:Inpp5e'

705439

Institutional Source

Beutler Lab

Gene Symbol

Inpp5e

Ensembl Gene

ENSMUSG00000026925

Gene Name

inositol polyphosphate-5-phosphatase E

Synonyms

72kDa, 1200002L24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9310 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

26396249-26409203 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 26397928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 619 (I619L)

Ref Sequence

ENSEMBL: ENSMUSP00000119485 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076431] [ENSMUST00000114090] [ENSMUST00000114093] [ENSMUST00000145701]

AlphaFold

Q9JII1

Predicted Effect

probably benign
Transcript: ENSMUST00000076431

SMART Domains

Protein: ENSMUSP00000075762
Gene: ENSMUSG00000026926

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M16	76	226	4.5e-47	PFAM
Pfam:Peptidase_M16_C	231	430	4.1e-43	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000114090

SMART Domains

Protein: ENSMUSP00000109724
Gene: ENSMUSG00000026925

Domain	Start	End	E-Value	Type
low complexity region	277	294	N/A	INTRINSIC
IPPc	300	602	1.27e-62	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114093

SMART Domains

Protein: ENSMUSP00000109727
Gene: ENSMUSG00000026926

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M16	76	226	1.6e-47	PFAM
Pfam:Peptidase_M16_C	231	420	9.6e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131109

SMART Domains

Protein: ENSMUSP00000118739
Gene: ENSMUSG00000026925

Domain	Start	End	E-Value	Type
Pfam:Exo_endo_phos	4	88	6.4e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144011

SMART Domains

Protein: ENSMUSP00000123272
Gene: ENSMUSG00000026925

Domain	Start	End	E-Value	Type
low complexity region	1	15	N/A	INTRINSIC
IPPc	21	206	1.76e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000145701
AA Change: I619L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119485
Gene: ENSMUSG00000026925
AA Change: I619L

Domain	Start	End	E-Value	Type
low complexity region	277	294	N/A	INTRINSIC
IPPc	300	602	1.27e-62	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase. InsP3 5-phosphatases hydrolyze Ins(1,4,5)P3, which mobilizes intracellular calcium and acts as a second messenger mediating cell responses to various stimulation. Studies of the mouse counterpart suggest that this protein may hydrolyze phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,5-bisphosphate on the cytoplasmic Golgi membrane and thereby regulate Golgi-vesicular trafficking. Mutations in this gene cause Joubert syndrome; a clinically and genetically heterogenous group of disorders characterized by midbrain-hindbrain malformation and various associated ciliopathies that include retinal dystrophy, nephronophthisis, liver fibrosis and polydactyly. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null mutation display signs of ciliopathies including prenatal and perinatal lethality, polycystic kidneys, arrest of eye development, abnormalities in primary cilia, cerebral developmental defects, and skeletal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030J22Rik	T	C	8: 116,972,120	I83V	possibly damaging	Het
Abcf1	G	A	17: 35,961,729	A288V	probably null	Het
Acer1	A	T	17: 56,955,598	V184D	probably damaging	Het
Apoh	T	C	11: 108,407,481		probably null	Het
Arid1a	T	C	4: 133,686,314	Y959C	unknown	Het
Asb3	A	T	11: 31,028,962	H84L	probably benign	Het
Atxn1	A	C	13: 45,568,018	Y134D	probably damaging	Het
BC055324	A	G	1: 163,964,520	C610R	probably damaging	Het
Btbd1	T	C	7: 81,829,237	Y52C	probably damaging	Het
Cabp2	A	G	19: 4,086,464	D170G	probably damaging	Het
Cacna1a	C	A	8: 84,536,417	A407E	probably damaging	Het
Cacna2d4	T	A	6: 119,271,953		probably null	Het
Cc2d2a	T	C	5: 43,695,146	F404S	probably damaging	Het
Cdh20	T	C	1: 104,947,336	M281T	probably damaging	Het
Cfap54	A	T	10: 92,962,315	M1694K	unknown	Het
Chd6	G	T	2: 161,039,261	T261K	probably damaging	Het
Cnksr1	T	C	4: 134,229,019	S585G	probably damaging	Het
Cntnap2	A	T	6: 46,001,347	Y312F	probably damaging	Het
Coa7	T	A	4: 108,338,313	Y146*	probably null	Het
Col28a1	T	C	6: 8,175,414	K145E	unknown	Het
Coq8b	T	A	7: 27,242,061	I221N	probably damaging	Het
Cpd	A	T	11: 76,814,781	L375*	probably null	Het
Dnah5	T	C	15: 28,448,433	F4214S	probably damaging	Het
Dock2	A	G	11: 34,294,139	F1067S	possibly damaging	Het
Dpp6	G	A	5: 27,631,441	A310T	probably damaging	Het
Dpp6	C	A	5: 27,725,644	L825I	probably benign	Het
Efcab5	A	G	11: 77,113,705	V929A	probably benign	Het
Ephx3	C	G	17: 32,189,316	D45H	probably benign	Het
Espl1	G	A	15: 102,296,850		probably null	Het
Gm4847	T	C	1: 166,632,712	R402G	probably benign	Het
Grid1	T	C	14: 35,026,805	L194S	probably damaging	Het
Heatr1	A	T	13: 12,438,610	H2122L	probably benign	Het
Il17b	T	A	18: 61,692,263	C123*	probably null	Het
Il17rc	T	C	6: 113,474,249	L181P	probably damaging	Het
Itgax	C	A	7: 128,142,260	Y814*	probably null	Het
Marcks	C	T	10: 37,136,491	E183K	unknown	Het
Mefv	T	C	16: 3,715,388	T340A	probably benign	Het
Mical2	A	G	7: 112,351,713	K958R	probably benign	Het
Mkl2	T	A	16: 13,401,090	D533E	probably benign	Het
Mtor	T	A	4: 148,469,377	L811Q	probably benign	Het
Myh4	A	G	11: 67,254,744	Y1351C	probably damaging	Het
Neb	T	C	2: 52,263,696	M2406V	probably benign	Het
Nebl	T	C	2: 17,348,867	T214A	probably benign	Het
Nlrx1	A	T	9: 44,253,408	I913N	probably damaging	Het
Npr2	G	T	4: 43,632,404	A74S	probably benign	Het
Olfr1220	T	A	2: 89,097,913	S5C	probably damaging	Het
Olfr711	C	A	7: 106,971,471	C291F	probably damaging	Het
Olfr794	T	A	10: 129,570,818	N54K	probably benign	Het
Pard3b	G	T	1: 62,166,369	V441F	probably damaging	Het
Pcsk1	G	A	13: 75,090,072	R4K	probably benign	Het
Pisd	G	T	5: 32,737,440	N337K	possibly damaging	Het
Pml	T	C	9: 58,249,662	K10R	probably benign	Het
Prkci	T	C	3: 31,029,515	W132R	probably damaging	Het
Prrc2a	A	T	17: 35,155,999	M1225K	probably benign	Het
Prss23	T	C	7: 89,509,934	D309G	probably damaging	Het
Pxdn	G	A	12: 30,002,052	G743S	probably damaging	Het
Rab29	A	T	1: 131,872,122	E145V	probably damaging	Het
Rasef	C	T	4: 73,735,719		probably null	Het
Rcbtb1	T	G	14: 59,235,250	I496S	probably benign	Het
Rcor1	T	C	12: 111,099,959	Y228H		Het
Reep5	C	T	18: 34,357,169	V92I	probably damaging	Het
Rfx3	T	C	19: 27,849,929	S86G	probably benign	Het
Rptn	T	A	3: 93,397,077	D572E	probably benign	Het
Rsl1	A	T	13: 67,176,446		probably null	Het
Sbf2	T	C	7: 110,315,085	E1630G	possibly damaging	Het
Sele	G	A	1: 164,049,406	V84I	probably benign	Het
Serpina1b	T	C	12: 103,732,497	D31G	probably benign	Het
Serpina3c	T	C	12: 104,149,554	I244V	probably benign	Het
Serpinb6e	A	G	13: 33,833,221	V272A	probably benign	Het
Serpinb9b	A	G	13: 33,035,540	D150G	probably benign	Het
Sgpp1	T	C	12: 75,722,600	T265A	probably benign	Het
Slc9a1	T	A	4: 133,416,370	M389K	probably damaging	Het
Slco3a1	A	T	7: 74,554,488	C35S	probably damaging	Het
Slco6d1	T	A	1: 98,499,894	V650E	possibly damaging	Het
Slit2	T	C	5: 48,192,226	V274A	possibly damaging	Het
Snd1	A	G	6: 28,795,937	E593G	probably null	Het
Spata2l	C	T	8: 123,234,134	V139M	probably benign	Het
Suco	T	C	1: 161,856,858	K231R	probably damaging	Het
Tenm3	C	A	8: 48,555,900		probably benign	Het
Tg	T	C	15: 66,827,269	S2415P	possibly damaging	Het
Traf6	C	A	2: 101,696,727	A274D	possibly damaging	Het
Usp14	A	G	18: 9,996,239	I447T	possibly damaging	Het
Usp32	G	A	11: 85,051,202	L355F	probably benign	Het
Vcpip1	T	C	1: 9,747,702	N152S	possibly damaging	Het
Vgf	A	G	5: 137,032,256	Q424R	probably benign	Het
Vmn2r84	A	T	10: 130,392,124	M81K	possibly damaging	Het
Washc5	G	A	15: 59,346,218	A732V	possibly damaging	Het
Wdr63	C	T	3: 146,097,140		probably null	Het
Xrcc3	T	G	12: 111,805,051	D213A	probably damaging	Het
Zeb2	T	C	2: 44,996,976	T690A	probably benign	Het
Zfat	G	A	15: 68,084,401	S1212L	probably damaging	Het
Zfp623	C	T	15: 75,948,100	L302F	probably damaging	Het
Zfp799	A	C	17: 32,820,759	C178G	possibly damaging	Het
Zfy1	T	C	Y: 727,634	E348G	unknown	Het
Zhx3	A	G	2: 160,779,473	W925R	possibly damaging	Het

Other mutations in Inpp5e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Inpp5e	APN	2	26408521	missense	probably benign
IGL00943:Inpp5e	APN	2	26400151	splice site	probably benign
IGL01518:Inpp5e	APN	2	26397934	missense	probably damaging	1.00
R0212:Inpp5e	UTSW	2	26408340	splice site	probably null
R1818:Inpp5e	UTSW	2	26397874	missense	probably benign	0.00
R1876:Inpp5e	UTSW	2	26408157	missense	possibly damaging	0.91
R2508:Inpp5e	UTSW	2	26399343	missense	probably damaging	1.00
R4175:Inpp5e	UTSW	2	26400925	missense	probably damaging	0.99
R4647:Inpp5e	UTSW	2	26407914	missense	probably benign	0.01
R4668:Inpp5e	UTSW	2	26400994	missense	probably damaging	0.97
R4895:Inpp5e	UTSW	2	26397912	missense	probably damaging	1.00
R4908:Inpp5e	UTSW	2	26400906	missense	probably damaging	1.00
R5090:Inpp5e	UTSW	2	26399371	splice site	probably null
R5096:Inpp5e	UTSW	2	26399525	missense	probably damaging	1.00
R5830:Inpp5e	UTSW	2	26400415	missense	probably damaging	1.00
R6056:Inpp5e	UTSW	2	26407848	nonsense	probably null
R6899:Inpp5e	UTSW	2	26400048	missense	possibly damaging	0.77
R6939:Inpp5e	UTSW	2	26407762	splice site	probably null
R7003:Inpp5e	UTSW	2	26397865	missense	probably benign	0.01
R7164:Inpp5e	UTSW	2	26407983	missense	possibly damaging	0.66
R7275:Inpp5e	UTSW	2	26408092	missense	probably benign	0.00
R7285:Inpp5e	UTSW	2	26397858	missense	probably benign	0.36
R7468:Inpp5e	UTSW	2	26408149	missense	probably benign	0.00
R7873:Inpp5e	UTSW	2	26407945	nonsense	probably null
R8032:Inpp5e	UTSW	2	26396853	missense
R8146:Inpp5e	UTSW	2	26399262	missense	probably benign	0.00
R9227:Inpp5e	UTSW	2	26398604	missense	probably damaging	1.00
R9706:Inpp5e	UTSW	2	26402114	missense	probably benign	0.21
RF002:Inpp5e	UTSW	2	26408377	missense	possibly damaging	0.95
X0061:Inpp5e	UTSW	2	26402147	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCATTACAGGAGCAGCTGAG -3'
(R):5'- AGCTGAGTGAAGTTGAGGCC -3'

Sequencing Primer
(F):5'- GCTGAGAAGAAGCCCATCCTTTG -3'
(R):5'- GTGAAGTTGAGGCCAGCTC -3'

Posted On

2022-03-25