Incidental Mutation 'R9310:Chd6'
ID 705445
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Name chromodomain helicase DNA binding protein 6
Synonyms 5430439G14Rik, 6330406J24Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.745) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 160788898-160950995 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 160881181 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 261 (T261K)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782] [ENSMUST00000130265] [ENSMUST00000134178]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: T261K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: T261K

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130265
AA Change: T141K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117075
Gene: ENSMUSG00000057133
AA Change: T141K

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Blast:CHROMO 26 210 4e-80 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000123240
Gene: ENSMUSG00000057133
AA Change: T260K

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
CHROMO 288 354 1.35e-4 SMART
CHROMO 371 429 3.48e-7 SMART
DEXDc 455 657 1.73e-39 SMART
HELICc 811 895 3.84e-23 SMART
low complexity region 1079 1093 N/A INTRINSIC
Blast:DEXDc 1107 1152 4e-23 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 117,698,859 (GRCm39) I83V possibly damaging Het
Abcf1 G A 17: 36,272,621 (GRCm39) A288V probably null Het
Acer1 A T 17: 57,262,598 (GRCm39) V184D probably damaging Het
Apoh T C 11: 108,298,307 (GRCm39) probably null Het
Arid1a T C 4: 133,413,625 (GRCm39) Y959C unknown Het
Asb3 A T 11: 30,978,962 (GRCm39) H84L probably benign Het
Atxn1 A C 13: 45,721,494 (GRCm39) Y134D probably damaging Het
Btbd1 T C 7: 81,478,985 (GRCm39) Y52C probably damaging Het
Cabp2 A G 19: 4,136,464 (GRCm39) D170G probably damaging Het
Cacna1a C A 8: 85,263,046 (GRCm39) A407E probably damaging Het
Cacna2d4 T A 6: 119,248,914 (GRCm39) probably null Het
Cc2d2a T C 5: 43,852,488 (GRCm39) F404S probably damaging Het
Cdh20 T C 1: 104,875,061 (GRCm39) M281T probably damaging Het
Cfap54 A T 10: 92,798,177 (GRCm39) M1694K unknown Het
Cnksr1 T C 4: 133,956,330 (GRCm39) S585G probably damaging Het
Cntnap2 A T 6: 45,978,281 (GRCm39) Y312F probably damaging Het
Coa7 T A 4: 108,195,510 (GRCm39) Y146* probably null Het
Col28a1 T C 6: 8,175,414 (GRCm39) K145E unknown Het
Coq8b T A 7: 26,941,486 (GRCm39) I221N probably damaging Het
Cpd A T 11: 76,705,607 (GRCm39) L375* probably null Het
Dnah5 T C 15: 28,448,579 (GRCm39) F4214S probably damaging Het
Dnai3 C T 3: 145,802,895 (GRCm39) probably null Het
Dock2 A G 11: 34,244,139 (GRCm39) F1067S possibly damaging Het
Dpp6 G A 5: 27,836,439 (GRCm39) A310T probably damaging Het
Dpp6 C A 5: 27,930,642 (GRCm39) L825I probably benign Het
Efcab5 A G 11: 77,004,531 (GRCm39) V929A probably benign Het
Ephx3 C G 17: 32,408,290 (GRCm39) D45H probably benign Het
Espl1 G A 15: 102,205,285 (GRCm39) probably null Het
Firrm A G 1: 163,792,089 (GRCm39) C610R probably damaging Het
Gm4847 T C 1: 166,460,281 (GRCm39) R402G probably benign Het
Grid1 T C 14: 34,748,762 (GRCm39) L194S probably damaging Het
Heatr1 A T 13: 12,453,491 (GRCm39) H2122L probably benign Het
Il17b T A 18: 61,825,334 (GRCm39) C123* probably null Het
Il17rc T C 6: 113,451,210 (GRCm39) L181P probably damaging Het
Inpp5e T A 2: 26,287,940 (GRCm39) I619L probably benign Het
Itgax C A 7: 127,741,432 (GRCm39) Y814* probably null Het
Marcks C T 10: 37,012,487 (GRCm39) E183K unknown Het
Mefv T C 16: 3,533,252 (GRCm39) T340A probably benign Het
Mical2 A G 7: 111,950,920 (GRCm39) K958R probably benign Het
Mrtfb T A 16: 13,218,954 (GRCm39) D533E probably benign Het
Mtor T A 4: 148,553,834 (GRCm39) L811Q probably benign Het
Myh4 A G 11: 67,145,570 (GRCm39) Y1351C probably damaging Het
Neb T C 2: 52,153,708 (GRCm39) M2406V probably benign Het
Nebl T C 2: 17,353,678 (GRCm39) T214A probably benign Het
Nlrx1 A T 9: 44,164,705 (GRCm39) I913N probably damaging Het
Npr2 G T 4: 43,632,404 (GRCm39) A74S probably benign Het
Or4c115 T A 2: 88,928,257 (GRCm39) S5C probably damaging Het
Or6b6 C A 7: 106,570,678 (GRCm39) C291F probably damaging Het
Or6c88 T A 10: 129,406,687 (GRCm39) N54K probably benign Het
Pard3b G T 1: 62,205,528 (GRCm39) V441F probably damaging Het
Pcsk1 G A 13: 75,238,191 (GRCm39) R4K probably benign Het
Pisd G T 5: 32,894,784 (GRCm39) N337K possibly damaging Het
Pml T C 9: 58,156,945 (GRCm39) K10R probably benign Het
Prkci T C 3: 31,083,664 (GRCm39) W132R probably damaging Het
Prrc2a A T 17: 35,374,975 (GRCm39) M1225K probably benign Het
Prss23 T C 7: 89,159,142 (GRCm39) D309G probably damaging Het
Pxdn G A 12: 30,052,051 (GRCm39) G743S probably damaging Het
Rab29 A T 1: 131,799,860 (GRCm39) E145V probably damaging Het
Rasef C T 4: 73,653,956 (GRCm39) probably null Het
Rcbtb1 T G 14: 59,472,699 (GRCm39) I496S probably benign Het
Rcor1 T C 12: 111,066,393 (GRCm39) Y228H Het
Reep5 C T 18: 34,490,222 (GRCm39) V92I probably damaging Het
Rfx3 T C 19: 27,827,329 (GRCm39) S86G probably benign Het
Rptn T A 3: 93,304,384 (GRCm39) D572E probably benign Het
Rsl1 A T 13: 67,324,510 (GRCm39) probably null Het
Sbf2 T C 7: 109,914,292 (GRCm39) E1630G possibly damaging Het
Sele G A 1: 163,876,975 (GRCm39) V84I probably benign Het
Serpina1b T C 12: 103,698,756 (GRCm39) D31G probably benign Het
Serpina3c T C 12: 104,115,813 (GRCm39) I244V probably benign Het
Serpinb6e A G 13: 34,017,204 (GRCm39) V272A probably benign Het
Serpinb9b A G 13: 33,219,523 (GRCm39) D150G probably benign Het
Sgpp1 T C 12: 75,769,374 (GRCm39) T265A probably benign Het
Slc9a1 T A 4: 133,143,681 (GRCm39) M389K probably damaging Het
Slco3a1 A T 7: 74,204,236 (GRCm39) C35S probably damaging Het
Slco6d1 T A 1: 98,427,619 (GRCm39) V650E possibly damaging Het
Slit2 T C 5: 48,349,568 (GRCm39) V274A possibly damaging Het
Snd1 A G 6: 28,795,936 (GRCm39) E593G probably null Het
Spata2l C T 8: 123,960,873 (GRCm39) V139M probably benign Het
Suco T C 1: 161,684,427 (GRCm39) K231R probably damaging Het
Tenm3 C A 8: 49,008,935 (GRCm39) probably benign Het
Tg T C 15: 66,699,118 (GRCm39) S2415P possibly damaging Het
Traf6 C A 2: 101,527,072 (GRCm39) A274D possibly damaging Het
Usp14 A G 18: 9,996,239 (GRCm39) I447T possibly damaging Het
Usp32 G A 11: 84,942,028 (GRCm39) L355F probably benign Het
Vcpip1 T C 1: 9,817,927 (GRCm39) N152S possibly damaging Het
Vgf A G 5: 137,061,110 (GRCm39) Q424R probably benign Het
Vmn2r84 A T 10: 130,227,993 (GRCm39) M81K possibly damaging Het
Washc5 G A 15: 59,218,067 (GRCm39) A732V possibly damaging Het
Xrcc3 T G 12: 111,771,485 (GRCm39) D213A probably damaging Het
Zeb2 T C 2: 44,886,988 (GRCm39) T690A probably benign Het
Zfat G A 15: 67,956,250 (GRCm39) S1212L probably damaging Het
Zfp623 C T 15: 75,819,949 (GRCm39) L302F probably damaging Het
Zfp799 A C 17: 33,039,733 (GRCm39) C178G possibly damaging Het
Zfy1 T C Y: 727,634 (GRCm39) E348G unknown Het
Zhx3 A G 2: 160,621,393 (GRCm39) W925R possibly damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 160,883,999 (GRCm39) missense probably benign 0.01
IGL00899:Chd6 APN 2 160,871,218 (GRCm39) splice site probably benign
IGL01104:Chd6 APN 2 160,803,847 (GRCm39) missense probably damaging 1.00
IGL01295:Chd6 APN 2 160,830,290 (GRCm39) splice site probably benign
IGL01717:Chd6 APN 2 160,807,179 (GRCm39) missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160,803,294 (GRCm39) missense probably benign 0.00
IGL01814:Chd6 APN 2 160,901,849 (GRCm39) missense probably benign 0.25
IGL02016:Chd6 APN 2 160,825,598 (GRCm39) missense probably damaging 1.00
IGL02104:Chd6 APN 2 160,819,432 (GRCm39) missense probably benign
IGL02158:Chd6 APN 2 160,868,212 (GRCm39) missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160,807,595 (GRCm39) missense probably damaging 1.00
IGL02472:Chd6 APN 2 160,826,372 (GRCm39) splice site probably benign
IGL02522:Chd6 APN 2 160,807,716 (GRCm39) missense probably benign 0.30
IGL02626:Chd6 APN 2 160,881,270 (GRCm39) splice site probably benign
IGL02727:Chd6 APN 2 160,811,383 (GRCm39) missense probably damaging 0.96
IGL02738:Chd6 APN 2 160,807,618 (GRCm39) missense probably benign 0.45
IGL02743:Chd6 APN 2 160,802,183 (GRCm39) missense probably damaging 1.00
IGL02800:Chd6 APN 2 160,826,552 (GRCm39) missense probably damaging 1.00
IGL02811:Chd6 APN 2 160,832,221 (GRCm39) missense probably damaging 1.00
IGL02850:Chd6 APN 2 160,861,536 (GRCm39) nonsense probably null
IGL02979:Chd6 APN 2 160,808,090 (GRCm39) missense possibly damaging 0.48
IGL02993:Chd6 APN 2 160,894,304 (GRCm39) splice site probably benign
IGL03277:Chd6 APN 2 160,824,981 (GRCm39) missense probably null 1.00
IGL03346:Chd6 APN 2 160,802,282 (GRCm39) missense probably benign 0.00
IGL03357:Chd6 APN 2 160,859,936 (GRCm39) splice site probably benign
IGL03134:Chd6 UTSW 2 160,807,403 (GRCm39) missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0106:Chd6 UTSW 2 160,809,822 (GRCm39) missense probably damaging 1.00
R0212:Chd6 UTSW 2 160,894,767 (GRCm39) missense probably damaging 0.99
R0363:Chd6 UTSW 2 160,856,244 (GRCm39) missense probably damaging 1.00
R0399:Chd6 UTSW 2 160,894,608 (GRCm39) missense probably damaging 1.00
R0511:Chd6 UTSW 2 160,834,111 (GRCm39) missense probably damaging 0.99
R0771:Chd6 UTSW 2 160,861,500 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1147:Chd6 UTSW 2 160,832,191 (GRCm39) missense probably damaging 1.00
R1184:Chd6 UTSW 2 160,872,722 (GRCm39) missense probably damaging 1.00
R1277:Chd6 UTSW 2 160,809,735 (GRCm39) missense probably damaging 1.00
R1396:Chd6 UTSW 2 160,825,023 (GRCm39) missense probably damaging 1.00
R1647:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1648:Chd6 UTSW 2 160,883,978 (GRCm39) missense probably damaging 1.00
R1745:Chd6 UTSW 2 160,823,587 (GRCm39) missense probably damaging 0.96
R1766:Chd6 UTSW 2 160,808,559 (GRCm39) missense probably damaging 1.00
R1871:Chd6 UTSW 2 160,832,176 (GRCm39) missense probably damaging 1.00
R1928:Chd6 UTSW 2 160,809,920 (GRCm39) splice site probably benign
R1973:Chd6 UTSW 2 160,808,307 (GRCm39) missense probably damaging 0.99
R2200:Chd6 UTSW 2 160,825,673 (GRCm39) missense probably damaging 1.00
R2340:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2341:Chd6 UTSW 2 160,807,679 (GRCm39) frame shift probably null
R2519:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160,809,800 (GRCm39) missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160,808,472 (GRCm39) small deletion probably benign
R3426:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R3427:Chd6 UTSW 2 160,832,175 (GRCm39) missense probably damaging 1.00
R4042:Chd6 UTSW 2 160,830,253 (GRCm39) missense probably damaging 1.00
R4273:Chd6 UTSW 2 160,803,211 (GRCm39) missense probably benign 0.04
R4360:Chd6 UTSW 2 160,791,776 (GRCm39) missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160,807,238 (GRCm39) missense probably benign
R4458:Chd6 UTSW 2 160,871,796 (GRCm39) missense possibly damaging 0.66
R4583:Chd6 UTSW 2 160,856,114 (GRCm39) missense probably damaging 1.00
R4625:Chd6 UTSW 2 160,811,412 (GRCm39) missense probably damaging 1.00
R4740:Chd6 UTSW 2 160,812,103 (GRCm39) missense probably benign
R4765:Chd6 UTSW 2 160,808,164 (GRCm39) nonsense probably null
R4779:Chd6 UTSW 2 160,791,477 (GRCm39) missense probably damaging 1.00
R4877:Chd6 UTSW 2 160,871,219 (GRCm39) splice site probably benign
R5068:Chd6 UTSW 2 160,808,289 (GRCm39) missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160,791,873 (GRCm39) missense probably damaging 1.00
R5275:Chd6 UTSW 2 160,811,283 (GRCm39) missense probably benign
R5405:Chd6 UTSW 2 160,807,310 (GRCm39) missense probably benign
R5598:Chd6 UTSW 2 160,856,032 (GRCm39) missense probably damaging 1.00
R5693:Chd6 UTSW 2 160,807,185 (GRCm39) missense probably benign
R5697:Chd6 UTSW 2 160,859,971 (GRCm39) missense probably damaging 1.00
R5715:Chd6 UTSW 2 160,791,798 (GRCm39) missense probably benign 0.00
R5759:Chd6 UTSW 2 160,825,682 (GRCm39) missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160,798,999 (GRCm39) missense probably damaging 1.00
R5761:Chd6 UTSW 2 160,798,998 (GRCm39) missense probably damaging 1.00
R5954:Chd6 UTSW 2 160,807,747 (GRCm39) missense probably benign 0.00
R6025:Chd6 UTSW 2 160,807,502 (GRCm39) missense probably benign
R6104:Chd6 UTSW 2 160,856,052 (GRCm39) missense probably damaging 1.00
R6247:Chd6 UTSW 2 160,791,968 (GRCm39) missense probably damaging 1.00
R6393:Chd6 UTSW 2 160,821,407 (GRCm39) missense probably damaging 1.00
R6452:Chd6 UTSW 2 160,807,418 (GRCm39) missense possibly damaging 0.76
R6468:Chd6 UTSW 2 160,854,987 (GRCm39) missense probably damaging 1.00
R6784:Chd6 UTSW 2 160,808,174 (GRCm39) missense probably damaging 1.00
R6803:Chd6 UTSW 2 160,802,279 (GRCm39) missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160,807,650 (GRCm39) missense probably benign
R6895:Chd6 UTSW 2 160,830,260 (GRCm39) missense probably damaging 1.00
R6925:Chd6 UTSW 2 160,855,047 (GRCm39) missense probably damaging 0.98
R7061:Chd6 UTSW 2 160,867,885 (GRCm39) nonsense probably null
R7064:Chd6 UTSW 2 160,791,983 (GRCm39) missense probably damaging 1.00
R7248:Chd6 UTSW 2 160,803,199 (GRCm39) nonsense probably null
R7287:Chd6 UTSW 2 160,850,312 (GRCm39) missense probably benign 0.07
R7431:Chd6 UTSW 2 160,868,248 (GRCm39) missense possibly damaging 0.92
R7486:Chd6 UTSW 2 160,791,923 (GRCm39) missense probably damaging 1.00
R7509:Chd6 UTSW 2 160,855,074 (GRCm39) missense probably damaging 1.00
R7699:Chd6 UTSW 2 160,867,863 (GRCm39) missense probably benign 0.13
R7748:Chd6 UTSW 2 160,808,539 (GRCm39) missense probably benign 0.37
R7785:Chd6 UTSW 2 160,812,095 (GRCm39) missense possibly damaging 0.51
R8002:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8261:Chd6 UTSW 2 160,799,002 (GRCm39) missense probably damaging 1.00
R8317:Chd6 UTSW 2 160,832,241 (GRCm39) missense probably damaging 1.00
R8388:Chd6 UTSW 2 160,861,571 (GRCm39) missense probably damaging 1.00
R8865:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8867:Chd6 UTSW 2 160,862,989 (GRCm39) missense probably benign 0.10
R8996:Chd6 UTSW 2 160,823,543 (GRCm39) missense probably damaging 1.00
R9091:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9270:Chd6 UTSW 2 160,871,793 (GRCm39) nonsense probably null
R9367:Chd6 UTSW 2 160,871,784 (GRCm39) missense possibly damaging 0.83
R9438:Chd6 UTSW 2 160,799,078 (GRCm39) missense probably benign 0.01
R9756:Chd6 UTSW 2 160,802,259 (GRCm39) missense probably benign
Z1088:Chd6 UTSW 2 160,808,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGACTGATATTTGGTGC -3'
(R):5'- GGCCTGTCATTAAGTGTAGATGATG -3'

Sequencing Primer
(F):5'- TTATTCCCAGTGCAGTAGGAAGCC -3'
(R):5'- AGATGATGGTGTTTGTGTGAAAATGC -3'
Posted On 2022-03-25