Incidental Mutation 'R9310:Npr2'
ID 705449
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Name natriuretic peptide receptor 2
Synonyms pwe, cn, guanylyl cyclase-B
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.782) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43631935-43651244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 43632404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 74 (A74S)
Ref Sequence ENSEMBL: ENSMUSP00000030191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000107874]
AlphaFold Q6VVW5
Predicted Effect probably benign
Transcript: ENSMUST00000030191
AA Change: A74S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: A74S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107874
AA Change: A74S

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: A74S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Coq8b T A 7: 27,242,061 I221N probably damaging Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
Anterior UTSW 4 43643622 missense probably damaging 1.00
palmar UTSW 4 43647553 missense probably damaging 1.00
Plantar UTSW 4 43640597 missense probably damaging 1.00
Ventral UTSW 4 43641254 missense probably damaging 1.00
R0066:Npr2 UTSW 4 43632329 missense probably benign 0.00
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 splice site probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2054:Npr2 UTSW 4 43646560 missense probably damaging 0.99
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R3730:Npr2 UTSW 4 43640999 missense possibly damaging 0.93
R4301:Npr2 UTSW 4 43641332 critical splice donor site probably null
R4352:Npr2 UTSW 4 43646592 missense probably damaging 1.00
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6364:Npr2 UTSW 4 43643622 missense probably damaging 1.00
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
R7380:Npr2 UTSW 4 43641254 missense probably damaging 1.00
R7432:Npr2 UTSW 4 43647155 missense probably damaging 0.96
R7500:Npr2 UTSW 4 43650415 missense probably damaging 1.00
R8235:Npr2 UTSW 4 43641603 missense probably benign 0.09
R8292:Npr2 UTSW 4 43643086 missense possibly damaging 0.70
R9684:Npr2 UTSW 4 43632491 missense probably damaging 1.00
R9746:Npr2 UTSW 4 43633527 missense possibly damaging 0.64
Z1176:Npr2 UTSW 4 43650720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCACTTTCTGTATCCGG -3'
(R):5'- TTAGCTGCAAAGCCAGAGG -3'

Sequencing Primer
(F):5'- TTCTGTATCCGGGCCGACTAAG -3'
(R):5'- TGTGAGGCAAAGCGAGCCA -3'
Posted On 2022-03-25