Incidental Mutation 'R9310:Coq8b'
ID 705467
Institutional Source Beutler Lab
Gene Symbol Coq8b
Ensembl Gene ENSMUSG00000003762
Gene Name coenzyme Q8B
Synonyms 0610012P18Rik, Adck4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9310 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 27233023-27257950 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 27242061 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 221 (I221N)
Ref Sequence ENSEMBL: ENSMUSP00000003860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003860] [ENSMUST00000108378] [ENSMUST00000128090]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000003860
AA Change: I221N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003860
Gene: ENSMUSG00000003762
AA Change: I221N

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.9e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108378
AA Change: I221N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104015
Gene: ENSMUSG00000003762
AA Change: I221N

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 314 4.4e-34 PFAM
low complexity region 348 364 N/A INTRINSIC
low complexity region 474 483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000128090
AA Change: I221N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123309
Gene: ENSMUSG00000003762
AA Change: I221N

DomainStartEndE-ValueType
low complexity region 93 109 N/A INTRINSIC
Pfam:ABC1 198 304 3.4e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two copies of a domain found in protein kinases. The encoded protein has a complete protein kinase catalytic domain, and a truncated domain that contains only the active and binding sites of the protein kinase domain, however, it is not known whether the protein has any kinase activity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030J22Rik T C 8: 116,972,120 I83V possibly damaging Het
Abcf1 G A 17: 35,961,729 A288V probably null Het
Acer1 A T 17: 56,955,598 V184D probably damaging Het
Apoh T C 11: 108,407,481 probably null Het
Arid1a T C 4: 133,686,314 Y959C unknown Het
Asb3 A T 11: 31,028,962 H84L probably benign Het
Atxn1 A C 13: 45,568,018 Y134D probably damaging Het
BC055324 A G 1: 163,964,520 C610R probably damaging Het
Btbd1 T C 7: 81,829,237 Y52C probably damaging Het
Cabp2 A G 19: 4,086,464 D170G probably damaging Het
Cacna1a C A 8: 84,536,417 A407E probably damaging Het
Cacna2d4 T A 6: 119,271,953 probably null Het
Cc2d2a T C 5: 43,695,146 F404S probably damaging Het
Cdh20 T C 1: 104,947,336 M281T probably damaging Het
Cfap54 A T 10: 92,962,315 M1694K unknown Het
Chd6 G T 2: 161,039,261 T261K probably damaging Het
Cnksr1 T C 4: 134,229,019 S585G probably damaging Het
Cntnap2 A T 6: 46,001,347 Y312F probably damaging Het
Coa7 T A 4: 108,338,313 Y146* probably null Het
Col28a1 T C 6: 8,175,414 K145E unknown Het
Cpd A T 11: 76,814,781 L375* probably null Het
Dnah5 T C 15: 28,448,433 F4214S probably damaging Het
Dock2 A G 11: 34,294,139 F1067S possibly damaging Het
Dpp6 G A 5: 27,631,441 A310T probably damaging Het
Dpp6 C A 5: 27,725,644 L825I probably benign Het
Efcab5 A G 11: 77,113,705 V929A probably benign Het
Ephx3 C G 17: 32,189,316 D45H probably benign Het
Espl1 G A 15: 102,296,850 probably null Het
Gm4847 T C 1: 166,632,712 R402G probably benign Het
Grid1 T C 14: 35,026,805 L194S probably damaging Het
Heatr1 A T 13: 12,438,610 H2122L probably benign Het
Il17b T A 18: 61,692,263 C123* probably null Het
Il17rc T C 6: 113,474,249 L181P probably damaging Het
Inpp5e T A 2: 26,397,928 I619L probably benign Het
Itgax C A 7: 128,142,260 Y814* probably null Het
Marcks C T 10: 37,136,491 E183K unknown Het
Mefv T C 16: 3,715,388 T340A probably benign Het
Mical2 A G 7: 112,351,713 K958R probably benign Het
Mkl2 T A 16: 13,401,090 D533E probably benign Het
Mtor T A 4: 148,469,377 L811Q probably benign Het
Myh4 A G 11: 67,254,744 Y1351C probably damaging Het
Neb T C 2: 52,263,696 M2406V probably benign Het
Nebl T C 2: 17,348,867 T214A probably benign Het
Nlrx1 A T 9: 44,253,408 I913N probably damaging Het
Npr2 G T 4: 43,632,404 A74S probably benign Het
Olfr1220 T A 2: 89,097,913 S5C probably damaging Het
Olfr711 C A 7: 106,971,471 C291F probably damaging Het
Olfr794 T A 10: 129,570,818 N54K probably benign Het
Pard3b G T 1: 62,166,369 V441F probably damaging Het
Pcsk1 G A 13: 75,090,072 R4K probably benign Het
Pisd G T 5: 32,737,440 N337K possibly damaging Het
Pml T C 9: 58,249,662 K10R probably benign Het
Prkci T C 3: 31,029,515 W132R probably damaging Het
Prrc2a A T 17: 35,155,999 M1225K probably benign Het
Prss23 T C 7: 89,509,934 D309G probably damaging Het
Pxdn G A 12: 30,002,052 G743S probably damaging Het
Rab29 A T 1: 131,872,122 E145V probably damaging Het
Rasef C T 4: 73,735,719 probably null Het
Rcbtb1 T G 14: 59,235,250 I496S probably benign Het
Rcor1 T C 12: 111,099,959 Y228H Het
Reep5 C T 18: 34,357,169 V92I probably damaging Het
Rfx3 T C 19: 27,849,929 S86G probably benign Het
Rptn T A 3: 93,397,077 D572E probably benign Het
Rsl1 A T 13: 67,176,446 probably null Het
Sbf2 T C 7: 110,315,085 E1630G possibly damaging Het
Sele G A 1: 164,049,406 V84I probably benign Het
Serpina1b T C 12: 103,732,497 D31G probably benign Het
Serpina3c T C 12: 104,149,554 I244V probably benign Het
Serpinb6e A G 13: 33,833,221 V272A probably benign Het
Serpinb9b A G 13: 33,035,540 D150G probably benign Het
Sgpp1 T C 12: 75,722,600 T265A probably benign Het
Slc9a1 T A 4: 133,416,370 M389K probably damaging Het
Slco3a1 A T 7: 74,554,488 C35S probably damaging Het
Slco6d1 T A 1: 98,499,894 V650E possibly damaging Het
Slit2 T C 5: 48,192,226 V274A possibly damaging Het
Snd1 A G 6: 28,795,937 E593G probably null Het
Spata2l C T 8: 123,234,134 V139M probably benign Het
Suco T C 1: 161,856,858 K231R probably damaging Het
Tenm3 C A 8: 48,555,900 probably benign Het
Tg T C 15: 66,827,269 S2415P possibly damaging Het
Traf6 C A 2: 101,696,727 A274D possibly damaging Het
Usp14 A G 18: 9,996,239 I447T possibly damaging Het
Usp32 G A 11: 85,051,202 L355F probably benign Het
Vcpip1 T C 1: 9,747,702 N152S possibly damaging Het
Vgf A G 5: 137,032,256 Q424R probably benign Het
Vmn2r84 A T 10: 130,392,124 M81K possibly damaging Het
Washc5 G A 15: 59,346,218 A732V possibly damaging Het
Wdr63 C T 3: 146,097,140 probably null Het
Xrcc3 T G 12: 111,805,051 D213A probably damaging Het
Zeb2 T C 2: 44,996,976 T690A probably benign Het
Zfat G A 15: 68,084,401 S1212L probably damaging Het
Zfp623 C T 15: 75,948,100 L302F probably damaging Het
Zfp799 A C 17: 32,820,759 C178G possibly damaging Het
Zfy1 T C Y: 727,634 E348G unknown Het
Zhx3 A G 2: 160,779,473 W925R possibly damaging Het
Other mutations in Coq8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Coq8b APN 7 27257477 missense probably benign
IGL01116:Coq8b APN 7 27239857 missense possibly damaging 0.82
IGL01123:Coq8b APN 7 27240084 missense probably damaging 1.00
IGL02949:Coq8b APN 7 27256613 missense possibly damaging 0.70
R0067:Coq8b UTSW 7 27233481 missense possibly damaging 0.87
R0690:Coq8b UTSW 7 27242249 missense probably benign 0.15
R1307:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1470:Coq8b UTSW 7 27252309 missense probably benign 0.10
R1551:Coq8b UTSW 7 27257482 missense probably damaging 1.00
R1682:Coq8b UTSW 7 27240124 missense probably benign 0.00
R1895:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R1945:Coq8b UTSW 7 27233980 small insertion probably benign
R1945:Coq8b UTSW 7 27233981 small insertion probably benign
R1946:Coq8b UTSW 7 27239874 missense possibly damaging 0.91
R2069:Coq8b UTSW 7 27257377 missense probably damaging 1.00
R3758:Coq8b UTSW 7 27242227 nonsense probably null
R4545:Coq8b UTSW 7 27233505 missense probably benign 0.45
R4838:Coq8b UTSW 7 27250591 missense probably damaging 1.00
R5181:Coq8b UTSW 7 27252322 missense possibly damaging 0.65
R5345:Coq8b UTSW 7 27250348 missense probably benign
R5806:Coq8b UTSW 7 27250625 nonsense probably null
R5943:Coq8b UTSW 7 27234003 missense probably damaging 1.00
R6005:Coq8b UTSW 7 27257325 nonsense probably null
R7028:Coq8b UTSW 7 27239868 missense probably damaging 1.00
R7709:Coq8b UTSW 7 27250537 missense probably damaging 0.98
R8300:Coq8b UTSW 7 27242246 missense possibly damaging 0.72
R9039:Coq8b UTSW 7 27250586 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CAGCCAAGAGTGAATCCCAG -3'
(R):5'- AGGTTCTCCACGTCACTCTG -3'

Sequencing Primer
(F):5'- GTGAATCCCAGGGTTGTTAACACC -3'
(R):5'- ACGTCACTCTGGATGCTCTGG -3'
Posted On 2022-03-25